EMAIL THIS PAGE TO A FRIEND

CDO1

cysteine dioxygenase type 1

94 Gene Product Result for
UniProtKB ID: Q16878, B2RAK4, P78513, Q6FHZ8, Q8TB64
Gene ID:
Mouse(12583) cysteine dioxygenase 1, cytosolic
Rat(81718) cysteine dioxygenase type 1
Zebrafish(393714) cysteine dioxygenase, type I
cow(514462) cysteine dioxygenase, type I
domestic cat(101090583) cysteine dioxygenase, type I
dog(474637) cysteine dioxygenase, type I
chicken(427391) cysteine dioxygenase, type I
sheep(101102489) cysteine dioxygenase, type I
domestic guinea pig(100719433) cysteine dioxygenase type 1
naked mole-rat(101721993) cysteine dioxygenase type 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1358 Human CDO ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001801 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001801 Rosetta Predictions human pricing
NM_052809 Rosetta Predictions rat pricing
NM_033037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053168 predicted 910
2 SASI_Hs01_00053169 predicted 1160
3 SASI_Hs01_00053170 predicted 464
4 SASI_Hs01_00053171 predicted 809
5 SASI_Hs01_00053172 predicted 609
6 SASI_Hs01_00053173 predicted 1027
7 SASI_Hs01_00053175 predicted 585
8 SASI_Hs02_00332577 predicted 600
9 SASI_Hs01_00053176 predicted 477
10 SASI_Hs01_00053177 predicted 453
11 SASI_Hs01_00053174 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060016 predicted 727
2 SASI_Rn02_00265615 predicted 494
3 SASI_Rn01_00060017 predicted 500
4 SASI_Rn01_00060018 predicted 683
5 SASI_Rn01_00060019 predicted 360
6 SASI_Rn01_00060020 predicted 357
7 SASI_Rn01_00060021 predicted 651
8 SASI_Rn01_00060022 predicted 690
9 SASI_Rn01_00060023 predicted 347
10 SASI_Rn01_00060024 predicted 591
11 SASI_Rn01_00060015 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121551 predicted 394
2 SASI_Mm01_00121552 predicted 748
3 SASI_Mm01_00121553 predicted 506
4 SASI_Mm02_00337266 predicted 509
5 SASI_Mm01_00121554 predicted 876
6 SASI_Mm01_00121555 predicted 881
7 SASI_Mm01_00121556 predicted 341
8 SASI_Mm01_00121557 predicted 373
9 SASI_Mm01_00121559 predicted 584
10 SASI_Mm02_00337267 predicted 884
11 SASI_Mm01_00121550 predicted 371
12 SASI_Mm01_00121558 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001801
VALIDATED
CDO1 MISSION shRNA Bacterial Glycerol Stock
cysteine dioxygenase type 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-645s1c1
Sequence:CCGGGCCTACATCAATGATTCCATTCTCGAGAATGGAATCATTGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-745s1c1
Sequence:CCGGGCCATGCCTTTGATCAAAGAACTCGAGTTCTTTGATCAAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-416s1c1
Sequence:CCGGCCAGTACAGGTATACCCGAAACTCGAGTTTCGGGTATACCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001801.1-499s1c1
Sequence:CCGGGCAGCAGTATTCATGATCATACTCGAGTATGATCATGAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-675s1c1
Sequence:CCGGCGAGTAGAGAACATCAGCCATCTCGAGATGGCTGATGTTCTCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-802s21c1
Sequence:CCGGGCCATGCCTTTGATCAAAGAACTCGAGTTCTTTGATCAAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-702s21c1
Sequence:CCGGGCCTACATCAATGATTCCATTCTCGAGAATGGAATCATTGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-473s21c1
Sequence:CCGGCCAGTACAGGTATACCCGAAACTCGAGTTTCGGGTATACCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-556s21c1
Sequence:CCGGGCAGCAGTATTCATGATCATACTCGAGTATGATCATGAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001801
VALIDATED
CDO1 MISSION shRNA shRNA Plasmid DNA
cysteine dioxygenase type 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-645s1c1
Sequence:CCGGGCCTACATCAATGATTCCATTCTCGAGAATGGAATCATTGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-745s1c1
Sequence:CCGGGCCATGCCTTTGATCAAAGAACTCGAGTTCTTTGATCAAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-416s1c1
Sequence:CCGGCCAGTACAGGTATACCCGAAACTCGAGTTTCGGGTATACCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001801.1-499s1c1
Sequence:CCGGGCAGCAGTATTCATGATCATACTCGAGTATGATCATGAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-675s1c1
Sequence:CCGGCGAGTAGAGAACATCAGCCATCTCGAGATGGCTGATGTTCTCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-802s21c1
Sequence:CCGGGCCATGCCTTTGATCAAAGAACTCGAGTTCTTTGATCAAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-702s21c1
Sequence:CCGGGCCTACATCAATGATTCCATTCTCGAGAATGGAATCATTGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-473s21c1
Sequence:CCGGCCAGTACAGGTATACCCGAAACTCGAGTTTCGGGTATACCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-556s21c1
Sequence:CCGGGCAGCAGTATTCATGATCATACTCGAGTATGATCATGAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001801
VALIDATED
CDO1 MISSION shRNA Lentiviral Transduction Particles
cysteine dioxygenase type 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-645s1c1
Sequence:CCGGGCCTACATCAATGATTCCATTCTCGAGAATGGAATCATTGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-745s1c1
Sequence:CCGGGCCATGCCTTTGATCAAAGAACTCGAGTTCTTTGATCAAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-416s1c1
Sequence:CCGGCCAGTACAGGTATACCCGAAACTCGAGTTTCGGGTATACCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001801.1-499s1c1
Sequence:CCGGGCAGCAGTATTCATGATCATACTCGAGTATGATCATGAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001801.1-675s1c1
Sequence:CCGGCGAGTAGAGAACATCAGCCATCTCGAGATGGCTGATGTTCTCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-802s21c1
Sequence:CCGGGCCATGCCTTTGATCAAAGAACTCGAGTTCTTTGATCAAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-702s21c1
Sequence:CCGGGCCTACATCAATGATTCCATTCTCGAGAATGGAATCATTGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-473s21c1
Sequence:CCGGCCAGTACAGGTATACCCGAAACTCGAGTTTCGGGTATACCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001801.2-556s21c1
Sequence:CCGGGCAGCAGTATTCATGATCATACTCGAGTATGATCATGAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033037
VALIDATED
CDO1 MISSION shRNA Bacterial Glycerol Stock
cysteine dioxygenase type 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-882s1c1
Sequence:CCGGGCTGTCCAGTTACACAGTTAACTCGAGTTAACTGTGTAACTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-591s1c1
Sequence:CCGGGCCTACATTAATGATTCCATTCTCGAGAATGGAATCATTAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-752s1c1
Sequence:CCGGGTTTGGAATCAGGACTCCATTCTCGAGAATGGAGTCCTGATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033037.2-347s1c1
Sequence:CCGGGTATGCCAAATTCGATCAATACTCGAGTATTGATCGAATTTGGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-346s1c1
Sequence:CCGGTGTATGCCAAATTCGATCAATCTCGAGATTGATCGAATTTGGCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033037.3-682s21c1
Sequence:CCGGTCGATACATGCCACGCCTTTGCTCGAGCAAAGGCGTGGCATGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033037.3-1180s21c1
Sequence:CCGGCTGGTCTCTGAACTCTAATAACTCGAGTTATTAGAGTTCAGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033037.3-356s21c1
Sequence:CCGGATTCGATCAATACAGGTATACCTCGAGGTATACCTGTATTGATCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033037.3-548s21c1
Sequence:CCGGGATGATCAAGAAGTCTGAAAGCTCGAGCTTTCAGACTTCTTGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033037.3-754s21c1
Sequence:CCGGTTGGAATCAGGACTCCATTTACTCGAGTAAATGGAGTCCTGATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033037
VALIDATED
CDO1 MISSION shRNA shRNA Plasmid DNA
cysteine dioxygenase type 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-882s1c1
Sequence:CCGGGCTGTCCAGTTACACAGTTAACTCGAGTTAACTGTGTAACTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-591s1c1
Sequence:CCGGGCCTACATTAATGATTCCATTCTCGAGAATGGAATCATTAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-752s1c1
Sequence:CCGGGTTTGGAATCAGGACTCCATTCTCGAGAATGGAGTCCTGATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033037.2-347s1c1
Sequence:CCGGGTATGCCAAATTCGATCAATACTCGAGTATTGATCGAATTTGGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-346s1c1
Sequence:CCGGTGTATGCCAAATTCGATCAATCTCGAGATTGATCGAATTTGGCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033037.3-682s21c1
Sequence:CCGGTCGATACATGCCACGCCTTTGCTCGAGCAAAGGCGTGGCATGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033037.3-1180s21c1
Sequence:CCGGCTGGTCTCTGAACTCTAATAACTCGAGTTATTAGAGTTCAGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033037.3-356s21c1
Sequence:CCGGATTCGATCAATACAGGTATACCTCGAGGTATACCTGTATTGATCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033037.3-548s21c1
Sequence:CCGGGATGATCAAGAAGTCTGAAAGCTCGAGCTTTCAGACTTCTTGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033037.3-754s21c1
Sequence:CCGGTTGGAATCAGGACTCCATTTACTCGAGTAAATGGAGTCCTGATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033037
VALIDATED
CDO1 MISSION shRNA Lentiviral Transduction Particles
cysteine dioxygenase type 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-882s1c1
Sequence:CCGGGCTGTCCAGTTACACAGTTAACTCGAGTTAACTGTGTAACTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-591s1c1
Sequence:CCGGGCCTACATTAATGATTCCATTCTCGAGAATGGAATCATTAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-752s1c1
Sequence:CCGGGTTTGGAATCAGGACTCCATTCTCGAGAATGGAGTCCTGATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033037.2-347s1c1
Sequence:CCGGGTATGCCAAATTCGATCAATACTCGAGTATTGATCGAATTTGGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033037.2-346s1c1
Sequence:CCGGTGTATGCCAAATTCGATCAATCTCGAGATTGATCGAATTTGGCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033037.3-682s21c1
Sequence:CCGGTCGATACATGCCACGCCTTTGCTCGAGCAAAGGCGTGGCATGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033037.3-1180s21c1
Sequence:CCGGCTGGTCTCTGAACTCTAATAACTCGAGTTATTAGAGTTCAGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033037.3-356s21c1
Sequence:CCGGATTCGATCAATACAGGTATACCTCGAGGTATACCTGTATTGATCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033037.3-548s21c1
Sequence:CCGGGATGATCAAGAAGTCTGAAAGCTCGAGCTTTCAGACTTCTTGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033037.3-754s21c1
Sequence:CCGGTTGGAATCAGGACTCCATTTACTCGAGTAAATGGAGTCCTGATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks