EMAIL THIS PAGE TO A FRIEND

CDON

cell adhesion associated, oncogene regulated

166 Gene Product Result for
Synonyms: CDO CDON1 HPE11 ORCAM
UniProtKB ID: Q4KMG0, O14631
Gene ID:
Human(50937) Summary: This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
Mouse(57810) cell adhesion molecule-related/down-regulated by oncogenes
Rat(50938) cell adhesion associated, oncogene regulated
naked mole-rat(101710761) cell adhesion associated, oncogene regulated
domestic guinea pig(100715247) cell adhesion associated, oncogene regulated
sheep(101113286) Cdon homolog (mouse)
Domestic Rabbit(100339951) Cdon homolog (mouse)
Zebrafish(280652) cell adhesion molecule-related/down-regulated by oncogenes
chicken(419710) Cdon homolog (mouse)
dog(489296) Cdon homolog (mouse)
cow(536011) Cdon homolog (mouse)
Horse(100064474) Cdon homolog (mouse)
domestic cat(101087264) Cdon homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021339 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021339 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021339 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016952 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016952 Rosetta Predictions human pricing
NM_017358 Rosetta Predictions rat pricing
NM_021339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022222 predicted 3007
2 SASI_Hs01_00022223 predicted 2325
3 SASI_Hs01_00022224 predicted 2562
4 SASI_Hs01_00022225 predicted 294
5 SASI_Hs02_00349957 predicted 1252
6 SASI_Hs01_00022226 predicted 3311
7 SASI_Hs01_00022228 predicted 566
8 SASI_Hs01_00022229 predicted 3913
9 SASI_Hs01_00022230 predicted 2539
10 SASI_Hs01_00022231 predicted 2866
11 SASI_Hs01_00022227 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261847 predicted 2994
2 SASI_Rn01_00034584 predicted 932
3 SASI_Rn01_00034585 predicted 3419
4 SASI_Rn01_00034586 predicted 2190
5 SASI_Rn02_00261848 predicted 2648
6 SASI_Rn01_00034587 predicted 559
7 SASI_Rn01_00034589 predicted 3094
8 SASI_Rn01_00034590 predicted 2588
9 SASI_Rn01_00034591 predicted 2639
10 SASI_Rn01_00034592 predicted 2534
11 SASI_Rn01_00034588 predicted 2556
12 SASI_Rn01_00034593 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325919 predicted 3565
2 SASI_Mm01_00181705 predicted 932
3 SASI_Mm01_00181704 predicted 2931
4 SASI_Mm02_00325920 predicted 2901
5 SASI_Mm01_00181710 predicted 3268
6 SASI_Mm01_00181712 predicted 1771
7 SASI_Mm01_00181711 predicted 2584
8 SASI_Mm01_00181709 predicted 1132
9 SASI_Mm01_00181713 predicted 597
10 SASI_Mm02_00325921 predicted 460
11 SASI_Mm01_00181706 predicted 879
12 SASI_Mm01_00181707 predicted 2553
13 SASI_Mm01_00181708 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021339
CDON MISSION shRNA Bacterial Glycerol Stock
cell adhesion associated, oncogene regulated
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021339.2-948s21c1
Sequence:CCGGGTACTGGAGCATGCGTCAATTCTCGAGAATTGACGCATGCTCCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021339.2-394s21c1
Sequence:CCGGCATCAACAATGCACGTTATTACTCGAGTAATAACGTGCATTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021339.2-2352s21c1
Sequence:CCGGTCTGTGGAAGTTCGTAGTTTACTCGAGTAAACTACGAACTTCCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-3344s1c1
Sequence:CCGGCCGGAACAACAATAGGTGTTTCTCGAGAAACACCTATTGTTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-1509s1c1
Sequence:CCGGGCTGGGAAATATACTTGTGAACTCGAGTTCACAAGTATATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-197s1c1
Sequence:CCGGCCGAATCTCATGGTTGCATAACTCGAGTTATGCAACCATGAGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-2904s1c1
Sequence:CCGGGATATGTTGTACCTCATCGTTCTCGAGAACGATGAGGTACAACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021339
CDON MISSION shRNA shRNA Plasmid DNA
cell adhesion associated, oncogene regulated
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021339.2-948s21c1
Sequence:CCGGGTACTGGAGCATGCGTCAATTCTCGAGAATTGACGCATGCTCCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021339.2-394s21c1
Sequence:CCGGCATCAACAATGCACGTTATTACTCGAGTAATAACGTGCATTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021339.2-2352s21c1
Sequence:CCGGTCTGTGGAAGTTCGTAGTTTACTCGAGTAAACTACGAACTTCCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-3344s1c1
Sequence:CCGGCCGGAACAACAATAGGTGTTTCTCGAGAAACACCTATTGTTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-1509s1c1
Sequence:CCGGGCTGGGAAATATACTTGTGAACTCGAGTTCACAAGTATATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-197s1c1
Sequence:CCGGCCGAATCTCATGGTTGCATAACTCGAGTTATGCAACCATGAGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-2904s1c1
Sequence:CCGGGATATGTTGTACCTCATCGTTCTCGAGAACGATGAGGTACAACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021339
CDON MISSION shRNA Lentiviral Transduction Particles
cell adhesion associated, oncogene regulated
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021339.2-948s21c1
Sequence:CCGGGTACTGGAGCATGCGTCAATTCTCGAGAATTGACGCATGCTCCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021339.2-394s21c1
Sequence:CCGGCATCAACAATGCACGTTATTACTCGAGTAATAACGTGCATTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021339.2-2352s21c1
Sequence:CCGGTCTGTGGAAGTTCGTAGTTTACTCGAGTAAACTACGAACTTCCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-3344s1c1
Sequence:CCGGCCGGAACAACAATAGGTGTTTCTCGAGAAACACCTATTGTTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-1509s1c1
Sequence:CCGGGCTGGGAAATATACTTGTGAACTCGAGTTCACAAGTATATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-197s1c1
Sequence:CCGGCCGAATCTCATGGTTGCATAACTCGAGTTATGCAACCATGAGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021339.1-2904s1c1
Sequence:CCGGGATATGTTGTACCTCATCGTTCTCGAGAACGATGAGGTACAACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016952
CDON MISSION shRNA Bacterial Glycerol Stock
cell adhesion associated, oncogene regulated
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016952.4-572s21c1
Sequence:CCGGCAAAGCTGAGGTGCGCTATAACTCGAGTTATAGCGCACCTCAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016952.4-1477s21c1
Sequence:CCGGCTCAAGTCCTGAGATCGAAATCTCGAGATTTCGATCTCAGGACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016952.2-3966s1c1
Sequence:CCGGCCAGTCATGTTCCAACTTCAACTCGAGTTGAAGTTGGAACATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016952.2-2672s1c1
Sequence:CCGGGCGATACTCAGATCATGCTAACTCGAGTTAGCATGATCTGAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016952.2-1356s1c1
Sequence:CCGGCGGTGGATTCAAGCCAGTTATCTCGAGATAACTGGCTTGAATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016952.2-2947s1c1
Sequence:CCGGGCTTCTGAATATCCTGTCAAACTCGAGTTTGACAGGATATTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016952
CDON MISSION shRNA shRNA Plasmid DNA
cell adhesion associated, oncogene regulated
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016952.4-572s21c1
Sequence:CCGGCAAAGCTGAGGTGCGCTATAACTCGAGTTATAGCGCACCTCAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016952.4-1477s21c1
Sequence:CCGGCTCAAGTCCTGAGATCGAAATCTCGAGATTTCGATCTCAGGACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016952.2-3966s1c1
Sequence:CCGGCCAGTCATGTTCCAACTTCAACTCGAGTTGAAGTTGGAACATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016952.2-2672s1c1
Sequence:CCGGGCGATACTCAGATCATGCTAACTCGAGTTAGCATGATCTGAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016952.2-1356s1c1
Sequence:CCGGCGGTGGATTCAAGCCAGTTATCTCGAGATAACTGGCTTGAATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016952.2-2947s1c1
Sequence:CCGGGCTTCTGAATATCCTGTCAAACTCGAGTTTGACAGGATATTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016952
CDON MISSION shRNA Lentiviral Transduction Particles
cell adhesion associated, oncogene regulated
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016952.4-572s21c1
Sequence:CCGGCAAAGCTGAGGTGCGCTATAACTCGAGTTATAGCGCACCTCAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016952.4-1477s21c1
Sequence:CCGGCTCAAGTCCTGAGATCGAAATCTCGAGATTTCGATCTCAGGACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016952.2-3966s1c1
Sequence:CCGGCCAGTCATGTTCCAACTTCAACTCGAGTTGAAGTTGGAACATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016952.2-2672s1c1
Sequence:CCGGGCGATACTCAGATCATGCTAACTCGAGTTAGCATGATCTGAGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016952.2-1356s1c1
Sequence:CCGGCGGTGGATTCAAGCCAGTTATCTCGAGATAACTGGCTTGAATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016952.2-2947s1c1
Sequence:CCGGGCTTCTGAATATCCTGTCAAACTCGAGTTTGACAGGATATTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks