EMAIL THIS PAGE TO A FRIEND

CDPF1

cysteine-rich, DPF motif domain containing 1

Synonyms: C22orf40
UniProtKB ID: Q6NVV7, A6NCA1, A9IU12, A9IU16, Q3ZCR8
Gene ID:
Mouse(72355) cysteine rich, DPF motif domain containing 1
domestic cat(101096581) cysteine-rich, DPF motif domain containing 1
dog(608872) cysteine-rich, DPF motif domain containing 1
cow(537366) cysteine-rich, DPF motif domain containing 1
sheep(101120820) cysteine-rich, DPF motif domain containing 1
domestic guinea pig(100725788) cysteine-rich, DPF motif domain containing 1
naked mole-rat(101724873) cysteine-rich, DPF motif domain containing 1
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_086905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_086905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_086905 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_197998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008917 Rosetta Predictions human pricing
NM_207327 Rosetta Predictions human pricing
NM_197998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103347 predicted 806
2 SASI_Hs01_00103348 predicted 714
3 SASI_Hs01_00103349 predicted 715
4 SASI_Hs01_00103350 predicted 80
5 SASI_Hs01_00103351 predicted 292
6 SASI_Hs01_00103352 predicted 266
7 SASI_Hs01_00103353 predicted 431
8 SASI_Hs01_00103354 predicted 78
9 SASI_Hs01_00103355 predicted 397
10 SASI_Hs01_00103356 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011703 predicted 908
2 SASI_Hs01_00011698 predicted 814
3 SASI_Hs01_00011699 predicted 684
4 SASI_Hs01_00011700 predicted 584
5 SASI_Hs01_00011701 predicted 582
6 SASI_Hs01_00011705 predicted 264
7 SASI_Hs02_00373870 predicted 250
8 SASI_Hs02_00373871 predicted 808
9 SASI_Hs02_00373872 predicted 289
10 SASI_Hs02_00373873 predicted 258
11 SASI_Hs01_00011702 predicted 74
12 SASI_Hs01_00011704 predicted 314
13 SASI_Hs01_00011706 predicted 72
14 SASI_Hs01_00011707 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028921 predicted 592
2 SASI_Mm01_00028923 predicted 222
3 SASI_Mm02_00350694 predicted 385
4 SASI_Mm01_00028924 predicted 473
5 SASI_Mm01_00028925 predicted 581
6 SASI_Mm01_00028926 predicted 724
7 SASI_Mm01_00028927 predicted 352
8 SASI_Mm01_00028929 predicted 434
9 SASI_Mm02_00350695 predicted 313
10 SASI_Mm02_00350696 predicted 574
11 SASI_Mm01_00028920 predicted 277
12 SASI_Mm01_00028922 predicted 678
13 SASI_Mm01_00028928 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_086905
CDPF1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich, DPF motif domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_086905.7-822s1c1
Sequence:CCGGGCTGCAATGGTCTCTCTGTAACTCGAGTTACAGAGAGACCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086905.7-270s1c1
Sequence:CCGGCCCGGAATGCAGTTTATTCTACTCGAGTAGAATAAACTGCATTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086905.7-80s1c1
Sequence:CCGGGAGTGTTTGAGTGTGAACTCTCTCGAGAGAGTTCACACTCAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086905.7-172s1c1
Sequence:CCGGGAAAGCTATGTCATGAAGGATCTCGAGATCCTTCATGACATAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_086905.7-986s1c1
Sequence:CCGGGAACCAGCTCATGTTTGGAAACTCGAGTTTCCAAACATGAGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_086905
CDPF1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich, DPF motif domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_086905.7-822s1c1
Sequence:CCGGGCTGCAATGGTCTCTCTGTAACTCGAGTTACAGAGAGACCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086905.7-270s1c1
Sequence:CCGGCCCGGAATGCAGTTTATTCTACTCGAGTAGAATAAACTGCATTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086905.7-80s1c1
Sequence:CCGGGAGTGTTTGAGTGTGAACTCTCTCGAGAGAGTTCACACTCAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086905.7-172s1c1
Sequence:CCGGGAAAGCTATGTCATGAAGGATCTCGAGATCCTTCATGACATAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_086905.7-986s1c1
Sequence:CCGGGAACCAGCTCATGTTTGGAAACTCGAGTTTCCAAACATGAGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_086905
CDPF1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich, DPF motif domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_086905.7-822s1c1
Sequence:CCGGGCTGCAATGGTCTCTCTGTAACTCGAGTTACAGAGAGACCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086905.7-270s1c1
Sequence:CCGGCCCGGAATGCAGTTTATTCTACTCGAGTAGAATAAACTGCATTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086905.7-80s1c1
Sequence:CCGGGAGTGTTTGAGTGTGAACTCTCTCGAGAGAGTTCACACTCAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086905.7-172s1c1
Sequence:CCGGGAAAGCTATGTCATGAAGGATCTCGAGATCCTTCATGACATAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_086905.7-986s1c1
Sequence:CCGGGAACCAGCTCATGTTTGGAAACTCGAGTTTCCAAACATGAGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197998
VALIDATED
CDPF1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich, DPF motif domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197998.1-463s1c1
Sequence:CCGGCAGGAAATCCAGCAGGATGTACTCGAGTACATCCTGCTGGATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197998.1-474s1c1
Sequence:CCGGGCAGGATGTAGAGAAGAGAAACTCGAGTTTCTCTTCTCTACATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197998.1-807s1c1
Sequence:CCGGCAGACTTCCAAACAACACAATCTCGAGATTGTGTTGTTTGGAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197998.1-798s1c1
Sequence:CCGGGCTTCTCTCCAGACTTCCAAACTCGAGTTTGGAAGTCTGGAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197998
VALIDATED
CDPF1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich, DPF motif domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197998.1-463s1c1
Sequence:CCGGCAGGAAATCCAGCAGGATGTACTCGAGTACATCCTGCTGGATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197998.1-474s1c1
Sequence:CCGGGCAGGATGTAGAGAAGAGAAACTCGAGTTTCTCTTCTCTACATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197998.1-807s1c1
Sequence:CCGGCAGACTTCCAAACAACACAATCTCGAGATTGTGTTGTTTGGAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197998.1-798s1c1
Sequence:CCGGGCTTCTCTCCAGACTTCCAAACTCGAGTTTGGAAGTCTGGAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197998
VALIDATED
CDPF1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich, DPF motif domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197998.1-463s1c1
Sequence:CCGGCAGGAAATCCAGCAGGATGTACTCGAGTACATCCTGCTGGATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197998.1-474s1c1
Sequence:CCGGGCAGGATGTAGAGAAGAGAAACTCGAGTTTCTCTTCTCTACATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197998.1-807s1c1
Sequence:CCGGCAGACTTCCAAACAACACAATCTCGAGATTGTGTTGTTTGGAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197998.1-798s1c1
Sequence:CCGGGCTTCTCTCCAGACTTCCAAACTCGAGTTTGGAAGTCTGGAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks