EMAIL THIS PAGE TO A FRIEND

CDR1

cerebellar degeneration-related protein 1, 34kDa

32 Gene Product Result for
Synonyms: CDR CDR34 CDR62A
Species: Human CDR1(1038), Mouse Cdr1(631990), Thale Cress CDR1(833310), domestic cat CDR1(101086460), cow CDR1(781214), naked mole-rat Cdr1(101709100), domestic guinea pig Cdr1(101787700)
UniProtKB ID: P51861, Q5JXH6
Gene ID:
Human(1038) Summary: Autoantibodies directed against the protein encoded by this intronless gene have been found in some patients with paraneoplastic cerebellar degeneration. The encoded protein contains several hexapeptide repeats. [provided by RefSeq, Jan 2010]
Mouse(631990) cerebellar degeneration related antigen 1
Thale Cress(833310) aspartic proteinase CDR1
domestic cat(101086460) cerebellar degeneration-related protein 1, 34kDa
cow(781214) cerebellar degeneration-related protein 1, 34kDa
naked mole-rat(101709100) cerebellar degeneration-related protein 1, 34kDa
domestic guinea pig(101787700) cerebellar degeneration-related protein 1, 34kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004065 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004065 Rosetta Predictions human pricing
XM_984839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067604 predicted 769
2 SASI_Hs01_00067605 predicted 225
3 SASI_Hs01_00067606 predicted 846
4 SASI_Hs01_00067607 predicted 915
5 SASI_Hs01_00067608 predicted 764
6 SASI_Hs01_00067610 predicted 398
7 SASI_Hs01_00067611 predicted 1070
8 SASI_Hs01_00067613 predicted 881
9 SASI_Hs02_00336853 predicted 949
10 SASI_Hs02_00336854 predicted 1060
11 SASI_Hs01_00067609 predicted 284
12 SASI_Hs01_00067612 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230540 predicted 70
2 SASI_Mm01_00230541 predicted 20
3 SASI_Mm01_00230542 predicted 106
4 SASI_Mm01_00230543 predicted 17
5 SASI_Mm01_00230544 predicted 11
6 SASI_Mm01_00230545 predicted 65
7 SASI_Mm01_00230546 predicted 16
8 SASI_Mm01_00230547 predicted 110
9 SASI_Mm01_00230548 predicted 78
10 SASI_Mm01_00230549 predicted 74
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004065
CDR1 MISSION shRNA Bacterial Glycerol Stock
cerebellar degeneration-related protein 1, 34kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-286s1c1
Sequence:CCGGCCTTTGTTGGAAGACACAAGTCTCGAGACTTGTGTCTTCCAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-403s1c1
Sequence:CCGGGAAGCTATGGATTTGAGGGAACTCGAGTTCCCTCAAATCCATAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-265s1c1
Sequence:CCGGGTACCTTTGTTGGAAGACGTACTCGAGTACGTCTTCCAACAAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-848s1c1
Sequence:CCGGGATTTGGTGGAAGACGTAGATCTCGAGATCTACGTCTTCCACCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004065.2-1060s1c1
Sequence:CCGGGCTGGAAGATCTGTATTTGATCTCGAGATCAAATACAGATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004065.2-1087s1c1
Sequence:CCGGCCTTGAAATTATTGGAAGACACTCGAGTGTCTTCCAATAATTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004065.2-1049s1c1
Sequence:CCGGGACATGGATTAGCTGGAAGATCTCGAGATCTTCCAGCTAATCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-341s1c1
Sequence:CCGGCTTTGTTGGAAGACGTGGATTCTCGAGAATCCACGTCTTCCAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004065
CDR1 MISSION shRNA shRNA Plasmid DNA
cerebellar degeneration-related protein 1, 34kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-286s1c1
Sequence:CCGGCCTTTGTTGGAAGACACAAGTCTCGAGACTTGTGTCTTCCAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-403s1c1
Sequence:CCGGGAAGCTATGGATTTGAGGGAACTCGAGTTCCCTCAAATCCATAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-265s1c1
Sequence:CCGGGTACCTTTGTTGGAAGACGTACTCGAGTACGTCTTCCAACAAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-848s1c1
Sequence:CCGGGATTTGGTGGAAGACGTAGATCTCGAGATCTACGTCTTCCACCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004065.2-1060s1c1
Sequence:CCGGGCTGGAAGATCTGTATTTGATCTCGAGATCAAATACAGATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004065.2-1087s1c1
Sequence:CCGGCCTTGAAATTATTGGAAGACACTCGAGTGTCTTCCAATAATTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004065.2-1049s1c1
Sequence:CCGGGACATGGATTAGCTGGAAGATCTCGAGATCTTCCAGCTAATCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-341s1c1
Sequence:CCGGCTTTGTTGGAAGACGTGGATTCTCGAGAATCCACGTCTTCCAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004065
CDR1 MISSION shRNA Lentiviral Transduction Particles
cerebellar degeneration-related protein 1, 34kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-286s1c1
Sequence:CCGGCCTTTGTTGGAAGACACAAGTCTCGAGACTTGTGTCTTCCAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-403s1c1
Sequence:CCGGGAAGCTATGGATTTGAGGGAACTCGAGTTCCCTCAAATCCATAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-265s1c1
Sequence:CCGGGTACCTTTGTTGGAAGACGTACTCGAGTACGTCTTCCAACAAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-848s1c1
Sequence:CCGGGATTTGGTGGAAGACGTAGATCTCGAGATCTACGTCTTCCACCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004065.2-1060s1c1
Sequence:CCGGGCTGGAAGATCTGTATTTGATCTCGAGATCAAATACAGATCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004065.2-1087s1c1
Sequence:CCGGCCTTGAAATTATTGGAAGACACTCGAGTGTCTTCCAATAATTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161008    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004065.2-1049s1c1
Sequence:CCGGGACATGGATTAGCTGGAAGATCTCGAGATCTTCCAGCTAATCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004065.2-341s1c1
Sequence:CCGGCTTTGTTGGAAGACGTGGATTCTCGAGAATCCACGTCTTCCAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks