EMAIL THIS PAGE TO A FRIEND

CDR2

cerebellar degeneration-related protein 2, 62kDa

Synonyms: CDR62 Yo
UniProtKB ID: Q01850, A8K8A8, Q13977
Gene ID:
Mouse(12585) cerebellar degeneration-related 2
Rat(308958) cerebellar degeneration-related 2
domestic guinea pig(100719546) cerebellar degeneration-related protein 2, 62kDa
sheep(101115091) cerebellar degeneration-related protein 2, 62kDa
chicken(416621) cerebellar degeneration-related protein 2, 62kDa
cow(534647) cerebellar degeneration-related protein 2, 62kDa
Horse(100058348) cerebellar degeneration-related protein 2, 62kDa
domestic cat(101091243) cerebellar degeneration-related protein 2, 62kDa
dog(479811) cerebellar degeneration-related protein 2, 62kDa
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001802 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001802 Rosetta Predictions human pricing
NM_001025682 Rosetta Predictions rat pricing
NM_007672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070363 predicted 1572
2 SASI_Hs01_00070364 predicted 1264
3 SASI_Hs01_00070366 predicted 1610
4 SASI_Hs01_00070367 predicted 1683
5 SASI_Hs01_00070368 predicted 840
6 SASI_Hs01_00070369 predicted 1563
7 SASI_Hs01_00070370 predicted 981
8 SASI_Hs01_00070371 predicted 634
9 SASI_Hs01_00070372 predicted 1571
10 SASI_Hs02_00332578 predicted 516
11 SASI_Hs01_00070365 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093589 predicted 1342
2 SASI_Rn01_00093590 predicted 1115
3 SASI_Rn01_00093591 predicted 285
4 SASI_Rn01_00093593 predicted 324
5 SASI_Rn01_00093594 predicted 230
6 SASI_Rn01_00093595 predicted 1382
7 SASI_Rn01_00093596 predicted 1487
8 SASI_Rn02_00203287 predicted 1388
9 SASI_Rn01_00093597 predicted 1427
10 SASI_Rn01_00093598 predicted 1349
11 SASI_Rn01_00093592 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312190 predicted 1523
2 SASI_Mm02_00312191 predicted 1087
3 SASI_Mm02_00312192 predicted 265
4 SASI_Mm01_00024904 predicted 1308
5 SASI_Mm01_00024905 predicted 877
6 SASI_Mm02_00312193 predicted 1672
7 SASI_Mm01_00024906 predicted 428
8 SASI_Mm02_00312194 predicted 1689
9 SASI_Mm02_00312195 predicted 1513
10 SASI_Mm02_00312196 predicted 1540
11 SASI_Mm01_00024902 predicted 379
12 SASI_Mm01_00024903 predicted 358
13 SASI_Mm01_00024907 predicted 396
14 SASI_Mm01_00024908 predicted 682
15 SASI_Mm01_00024909 predicted 644
16 SASI_Mm01_00024910 predicted 406
17 SASI_Mm01_00024911 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007672
VALIDATED
CDR2 MISSION shRNA Bacterial Glycerol Stock
cerebellar degeneration-related protein 2, 62kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_007672.1-436s1c1
Sequence:CCGGGAAACCAACCAGAAGCTAGTTCTCGAGAACTAGCTTCTGGTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_007672.1-433s1c1
Sequence:CCGGGAAGAAACCAACCAGAAGCTACTCGAGTAGCTTCTGGTTGGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189607    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007672.1-2083s1c1
Sequence:CCGGCCTGTTTGTATGCCCAGCATTCTCGAGAATGCTGGGCATACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_007672.2-1519s1c1
Sequence:CCGGCAGAATACAAAGCACTATTTACTCGAGTAAATAGTGCTTTGTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-464s21c1
Sequence:CCGGGGTGGAGCTTCTACGGCAAATCTCGAGATTTGCCGTAGAAGCTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-2228s21c1
Sequence:CCGGAGCTAGGCATGTCATAGTAATCTCGAGATTACTATGACATGCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-1623s21c1
Sequence:CCGGTACTGAGACTCCAGTTGTAACCTCGAGGTTACAACTGGAGTCTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-909s21c1
Sequence:CCGGAGCGTGGAGGCAGAGTATAAACTCGAGTTTATACTCTGCCTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-488s21c1
Sequence:CCGGTGAGCAGCATGCGAAAGTTTACTCGAGTAAACTTTCGCATGCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007672
VALIDATED
CDR2 MISSION shRNA shRNA Plasmid DNA
cerebellar degeneration-related protein 2, 62kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_007672.1-436s1c1
Sequence:CCGGGAAACCAACCAGAAGCTAGTTCTCGAGAACTAGCTTCTGGTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_007672.1-433s1c1
Sequence:CCGGGAAGAAACCAACCAGAAGCTACTCGAGTAGCTTCTGGTTGGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189607    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007672.1-2083s1c1
Sequence:CCGGCCTGTTTGTATGCCCAGCATTCTCGAGAATGCTGGGCATACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_007672.2-1519s1c1
Sequence:CCGGCAGAATACAAAGCACTATTTACTCGAGTAAATAGTGCTTTGTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-464s21c1
Sequence:CCGGGGTGGAGCTTCTACGGCAAATCTCGAGATTTGCCGTAGAAGCTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-2228s21c1
Sequence:CCGGAGCTAGGCATGTCATAGTAATCTCGAGATTACTATGACATGCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-1623s21c1
Sequence:CCGGTACTGAGACTCCAGTTGTAACCTCGAGGTTACAACTGGAGTCTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-909s21c1
Sequence:CCGGAGCGTGGAGGCAGAGTATAAACTCGAGTTTATACTCTGCCTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-488s21c1
Sequence:CCGGTGAGCAGCATGCGAAAGTTTACTCGAGTAAACTTTCGCATGCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007672
VALIDATED
CDR2 MISSION shRNA Lentiviral Transduction Particles
cerebellar degeneration-related protein 2, 62kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_007672.1-436s1c1
Sequence:CCGGGAAACCAACCAGAAGCTAGTTCTCGAGAACTAGCTTCTGGTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_007672.1-433s1c1
Sequence:CCGGGAAGAAACCAACCAGAAGCTACTCGAGTAGCTTCTGGTTGGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189607    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007672.1-2083s1c1
Sequence:CCGGCCTGTTTGTATGCCCAGCATTCTCGAGAATGCTGGGCATACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_007672.2-1519s1c1
Sequence:CCGGCAGAATACAAAGCACTATTTACTCGAGTAAATAGTGCTTTGTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-464s21c1
Sequence:CCGGGGTGGAGCTTCTACGGCAAATCTCGAGATTTGCCGTAGAAGCTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-2228s21c1
Sequence:CCGGAGCTAGGCATGTCATAGTAATCTCGAGATTACTATGACATGCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-1623s21c1
Sequence:CCGGTACTGAGACTCCAGTTGTAACCTCGAGGTTACAACTGGAGTCTCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-909s21c1
Sequence:CCGGAGCGTGGAGGCAGAGTATAAACTCGAGTTTATACTCTGCCTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007672.2-488s21c1
Sequence:CCGGTGAGCAGCATGCGAAAGTTTACTCGAGTAAACTTTCGCATGCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001802
VALIDATED
CDR2 MISSION shRNA Bacterial Glycerol Stock
cerebellar degeneration-related protein 2, 62kDa
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-1553s1c1
Sequence:CCGGCCCTACAACACCTCCAGAATACTCGAGTATTCTGGAGGTGTTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-525s1c1
Sequence:CCGGCTACGGCAGATGAACGAACAACTCGAGTTGTTCGTTCATCTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001802.1-1203s1c1
Sequence:CCGGCCGGAATCACATAGAAAGCCTCTCGAGAGGCTTTCTATGTGATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-1566s1c1
Sequence:CCGGCCAGAATACAAAGCGTTGTTTCTCGAGAAACAACGCTTTGTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001802.1-1779s1c1
Sequence:CCGGGCCTCATTGCTTTGCTTATTTCTCGAGAAATAAGCAAAGCAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001802.1-1139s1c1
Sequence:CCGGCTCTCTGTATGTTCCTTTCAACTCGAGTTGAAAGGAACATACAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-477s1c1
Sequence:CCGGCAGGAGCAGTTACAGGAAATTCTCGAGAATTTCCTGTAACTGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001802.1-1846s21c1
Sequence:CCGGCTCTGATCCACTTCCATTTAACTCGAGTTAAATGGAAGTGGATCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-1090s21c1
Sequence:CCGGTGCAGTCAGAGCATCCATTTGCTCGAGCAAATGGATGCTCTGACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001802.1-1567s21c1
Sequence:CCGGCAGAATACAAAGCGTTGTTTACTCGAGTAAACAACGCTTTGTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-1680s21c1
Sequence:CCGGCTCTAGCTCTACTACTAATTTCTCGAGAAATTAGTAGTAGAGCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-539s21c1
Sequence:CCGGCGAACAACATGCAAAGGTTTACTCGAGTAAACCTTTGCATGTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001802.1-970s21c1
Sequence:CCGGAGGAATATGGGCTCGTGTTAACTCGAGTTAACACGAGCCCATATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-1200s21c1
Sequence:CCGGGTGCCGGAATCACATAGAAAGCTCGAGCTTTCTATGTGATTCCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001802
VALIDATED
CDR2 MISSION shRNA shRNA Plasmid DNA
cerebellar degeneration-related protein 2, 62kDa
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-1553s1c1
Sequence:CCGGCCCTACAACACCTCCAGAATACTCGAGTATTCTGGAGGTGTTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-525s1c1
Sequence:CCGGCTACGGCAGATGAACGAACAACTCGAGTTGTTCGTTCATCTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001802.1-1203s1c1
Sequence:CCGGCCGGAATCACATAGAAAGCCTCTCGAGAGGCTTTCTATGTGATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-1566s1c1
Sequence:CCGGCCAGAATACAAAGCGTTGTTTCTCGAGAAACAACGCTTTGTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001802.1-1779s1c1
Sequence:CCGGGCCTCATTGCTTTGCTTATTTCTCGAGAAATAAGCAAAGCAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001802.1-1139s1c1
Sequence:CCGGCTCTCTGTATGTTCCTTTCAACTCGAGTTGAAAGGAACATACAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-477s1c1
Sequence:CCGGCAGGAGCAGTTACAGGAAATTCTCGAGAATTTCCTGTAACTGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001802.1-1846s21c1
Sequence:CCGGCTCTGATCCACTTCCATTTAACTCGAGTTAAATGGAAGTGGATCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-1090s21c1
Sequence:CCGGTGCAGTCAGAGCATCCATTTGCTCGAGCAAATGGATGCTCTGACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001802.1-1567s21c1
Sequence:CCGGCAGAATACAAAGCGTTGTTTACTCGAGTAAACAACGCTTTGTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-1680s21c1
Sequence:CCGGCTCTAGCTCTACTACTAATTTCTCGAGAAATTAGTAGTAGAGCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-539s21c1
Sequence:CCGGCGAACAACATGCAAAGGTTTACTCGAGTAAACCTTTGCATGTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001802.1-970s21c1
Sequence:CCGGAGGAATATGGGCTCGTGTTAACTCGAGTTAACACGAGCCCATATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-1200s21c1
Sequence:CCGGGTGCCGGAATCACATAGAAAGCTCGAGCTTTCTATGTGATTCCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001802
VALIDATED
CDR2 MISSION shRNA Lentiviral Transduction Particles
cerebellar degeneration-related protein 2, 62kDa
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-1553s1c1
Sequence:CCGGCCCTACAACACCTCCAGAATACTCGAGTATTCTGGAGGTGTTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-525s1c1
Sequence:CCGGCTACGGCAGATGAACGAACAACTCGAGTTGTTCGTTCATCTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001802.1-1203s1c1
Sequence:CCGGCCGGAATCACATAGAAAGCCTCTCGAGAGGCTTTCTATGTGATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-1566s1c1
Sequence:CCGGCCAGAATACAAAGCGTTGTTTCTCGAGAAACAACGCTTTGTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001802.1-1779s1c1
Sequence:CCGGGCCTCATTGCTTTGCTTATTTCTCGAGAAATAAGCAAAGCAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001802.1-1139s1c1
Sequence:CCGGCTCTCTGTATGTTCCTTTCAACTCGAGTTGAAAGGAACATACAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001802.1-477s1c1
Sequence:CCGGCAGGAGCAGTTACAGGAAATTCTCGAGAATTTCCTGTAACTGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001802.1-1846s21c1
Sequence:CCGGCTCTGATCCACTTCCATTTAACTCGAGTTAAATGGAAGTGGATCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-1090s21c1
Sequence:CCGGTGCAGTCAGAGCATCCATTTGCTCGAGCAAATGGATGCTCTGACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001802.1-1567s21c1
Sequence:CCGGCAGAATACAAAGCGTTGTTTACTCGAGTAAACAACGCTTTGTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-1680s21c1
Sequence:CCGGCTCTAGCTCTACTACTAATTTCTCGAGAAATTAGTAGTAGAGCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-539s21c1
Sequence:CCGGCGAACAACATGCAAAGGTTTACTCGAGTAAACCTTTGCATGTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001802.1-970s21c1
Sequence:CCGGAGGAATATGGGCTCGTGTTAACTCGAGTTAACACGAGCCCATATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001802.1-1200s21c1
Sequence:CCGGGTGCCGGAATCACATAGAAAGCTCGAGCTTTCTATGTGATTCCGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks