EMAIL THIS PAGE TO A FRIEND

CDR2L

cerebellar degeneration-related protein 2-like

109 Gene Product Result for
Synonyms: HUMPPA
UniProtKB ID: Q86X02, B4DFA7, Q15175
Gene ID:
Mouse(237988) cerebellar degeneration-related protein 2-like
Rat(360656) cerebellar degeneration-related protein 2-like
Zebrafish(336227) cerebellar degeneration-related protein 2-like
chicken(428685) cerebellar degeneration-related protein 2-like
cow(613582) cerebellar degeneration-related protein 2-like
Horse(100060171) cerebellar degeneration-related protein 2-like
domestic cat(101092970) cerebellar degeneration-related protein 2-like
dog(483306) cerebellar degeneration-related protein 2-like
sheep(101111563) cerebellar degeneration-related protein 2-like
naked mole-rat(101704869) cerebellar degeneration-related protein 2-like
domestic guinea pig(100730431) cerebellar degeneration-related protein 2-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014603 Rosetta Predictions human pricing
XM_001081680 Rosetta Predictions rat pricing
XM_340933 Rosetta Predictions rat pricing
NM_001080929 Rosetta Predictions mouse pricing
XM_111244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050964 predicted 920
2 SASI_Hs01_00050965 predicted 717
3 SASI_Hs01_00050966 predicted 1778
4 SASI_Hs01_00050967 predicted 1712
5 SASI_Hs01_00050968 predicted 1709
6 SASI_Hs01_00050969 predicted 1350
7 SASI_Hs01_00050970 predicted 1757
8 SASI_Hs01_00050971 predicted 1709
9 SASI_Hs01_00050972 predicted 1456
10 SASI_Hs01_00050973 predicted 1890
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372964 predicted 984
2 SASI_Rn02_00372965 predicted 987
3 SASI_Rn02_00372966 predicted 196
4 SASI_Rn02_00372967 predicted 1018
5 SASI_Rn02_00372968 predicted 617
6 SASI_Rn02_00372969 predicted 312
7 SASI_Rn02_00372970 predicted 301
8 SASI_Rn02_00372971 predicted 940
9 SASI_Rn02_00372972 predicted 264
10 SASI_Rn02_00372973 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392130 predicted 979
2 SASI_Rn02_00392131 predicted 993
3 SASI_Rn02_00392132 predicted 202
4 SASI_Rn02_00392133 predicted 1018
5 SASI_Rn02_00392134 predicted 626
6 SASI_Rn02_00392135 predicted 307
7 SASI_Rn02_00392136 predicted 300
8 SASI_Rn02_00392137 predicted 944
9 SASI_Rn02_00392138 predicted 269
10 SASI_Rn02_00392139 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293993 predicted 822
2 SASI_Mm02_00293994 predicted 1416
3 SASI_Mm02_00293995 predicted 1703
4 SASI_Mm02_00293996 predicted 612
5 SASI_Mm02_00293997 predicted 1638
6 SASI_Mm02_00293998 predicted 1277
7 SASI_Mm02_00293999 predicted 1405
8 SASI_Mm02_00294000 predicted 551
9 SASI_Mm02_00294001 predicted 1879
10 SASI_Mm02_00294002 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_111244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263549 predicted 401
2 SASI_Mm01_00263550 predicted 212
3 SASI_Mm01_00263551 predicted 501
4 SASI_Mm01_00263552 predicted 634
5 SASI_Mm01_00263553 predicted 258
6 SASI_Mm01_00263554 predicted 1561
7 SASI_Mm01_00263555 predicted 999
8 SASI_Mm01_00263556 predicted 1808
9 SASI_Mm01_00263557 predicted 191
10 SASI_Mm01_00263558 predicted 1220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014603
VALIDATED
CDR2L MISSION shRNA Bacterial Glycerol Stock
cerebellar degeneration-related protein 2-like
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-655s21c1
Sequence:CCGGCAAAGTCTATGAGCAGCTGGACTCGAGTCCAGCTGCTCATAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-568s21c1
Sequence:CCGGGTACTCCACCAATGAGGAACACTCGAGTGTTCCTCATTGGTGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-598s21c1
Sequence:CCGGGATCGAGTACCTAACCAAGCACTCGAGTGCTTGGTTAGGTACTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-1738s21c1
Sequence:CCGGGATCTTCTCCAGGATCCAGAACTCGAGTTCTGGATCCTGGAGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014603.1-2856s1c1
Sequence:CCGGCCATGCTGCATCGTGTTGTATCTCGAGATACAACACGATGCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-1732s1c1
Sequence:CCGGCAAAGAGATCTTCTCCAGGATCTCGAGATCCTGGAGAAGATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-560s1c1
Sequence:CCGGCAGCAGATGTACTCCACCAATCTCGAGATTGGTGGAGTACATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-1738s1c1
Sequence:CCGGGATCTTCTCCAGGATCCAGAACTCGAGTTCTGGATCCTGGAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-562s1c1
Sequence:CCGGGCAGATGTACTCCACCAATGACTCGAGTCATTGGTGGAGTACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-598s1c1
Sequence:CCGGGATCGAGTACCTAACCAAGCACTCGAGTGCTTGGTTAGGTACTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014603.1-596s1c1
Sequence:CCGGGAGATCGAGTACCTAACCAAGCTCGAGCTTGGTTAGGTACTCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-1756s1c1
Sequence:CCGGGAAGACCAAGGCTGACATCAACTCGAGTTGATGTCAGCCTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-568s1c1
Sequence:CCGGGTACTCCACCAATGAGGAACACTCGAGTGTTCCTCATTGGTGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014603.1-655s1c1
Sequence:CCGGCAAAGTCTATGAGCAGCTGGACTCGAGTCCAGCTGCTCATAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014603
VALIDATED
CDR2L MISSION shRNA shRNA Plasmid DNA
cerebellar degeneration-related protein 2-like
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-655s21c1
Sequence:CCGGCAAAGTCTATGAGCAGCTGGACTCGAGTCCAGCTGCTCATAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-568s21c1
Sequence:CCGGGTACTCCACCAATGAGGAACACTCGAGTGTTCCTCATTGGTGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-598s21c1
Sequence:CCGGGATCGAGTACCTAACCAAGCACTCGAGTGCTTGGTTAGGTACTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-1738s21c1
Sequence:CCGGGATCTTCTCCAGGATCCAGAACTCGAGTTCTGGATCCTGGAGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014603.1-2856s1c1
Sequence:CCGGCCATGCTGCATCGTGTTGTATCTCGAGATACAACACGATGCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-1732s1c1
Sequence:CCGGCAAAGAGATCTTCTCCAGGATCTCGAGATCCTGGAGAAGATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-560s1c1
Sequence:CCGGCAGCAGATGTACTCCACCAATCTCGAGATTGGTGGAGTACATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-1738s1c1
Sequence:CCGGGATCTTCTCCAGGATCCAGAACTCGAGTTCTGGATCCTGGAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-562s1c1
Sequence:CCGGGCAGATGTACTCCACCAATGACTCGAGTCATTGGTGGAGTACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-598s1c1
Sequence:CCGGGATCGAGTACCTAACCAAGCACTCGAGTGCTTGGTTAGGTACTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014603.1-596s1c1
Sequence:CCGGGAGATCGAGTACCTAACCAAGCTCGAGCTTGGTTAGGTACTCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-1756s1c1
Sequence:CCGGGAAGACCAAGGCTGACATCAACTCGAGTTGATGTCAGCCTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-568s1c1
Sequence:CCGGGTACTCCACCAATGAGGAACACTCGAGTGTTCCTCATTGGTGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014603.1-655s1c1
Sequence:CCGGCAAAGTCTATGAGCAGCTGGACTCGAGTCCAGCTGCTCATAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014603
VALIDATED
CDR2L MISSION shRNA Lentiviral Transduction Particles
cerebellar degeneration-related protein 2-like
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-655s21c1
Sequence:CCGGCAAAGTCTATGAGCAGCTGGACTCGAGTCCAGCTGCTCATAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-568s21c1
Sequence:CCGGGTACTCCACCAATGAGGAACACTCGAGTGTTCCTCATTGGTGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-598s21c1
Sequence:CCGGGATCGAGTACCTAACCAAGCACTCGAGTGCTTGGTTAGGTACTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014603.2-1738s21c1
Sequence:CCGGGATCTTCTCCAGGATCCAGAACTCGAGTTCTGGATCCTGGAGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014603.1-2856s1c1
Sequence:CCGGCCATGCTGCATCGTGTTGTATCTCGAGATACAACACGATGCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-1732s1c1
Sequence:CCGGCAAAGAGATCTTCTCCAGGATCTCGAGATCCTGGAGAAGATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-560s1c1
Sequence:CCGGCAGCAGATGTACTCCACCAATCTCGAGATTGGTGGAGTACATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-1738s1c1
Sequence:CCGGGATCTTCTCCAGGATCCAGAACTCGAGTTCTGGATCCTGGAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-562s1c1
Sequence:CCGGGCAGATGTACTCCACCAATGACTCGAGTCATTGGTGGAGTACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-598s1c1
Sequence:CCGGGATCGAGTACCTAACCAAGCACTCGAGTGCTTGGTTAGGTACTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014603.1-596s1c1
Sequence:CCGGGAGATCGAGTACCTAACCAAGCTCGAGCTTGGTTAGGTACTCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-1756s1c1
Sequence:CCGGGAAGACCAAGGCTGACATCAACTCGAGTTGATGTCAGCCTTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014603.1-568s1c1
Sequence:CCGGGTACTCCACCAATGAGGAACACTCGAGTGTTCCTCATTGGTGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014603.1-655s1c1
Sequence:CCGGCAAAGTCTATGAGCAGCTGGACTCGAGTCCAGCTGCTCATAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080929
VALIDATED
CDR2L MISSION shRNA Bacterial Glycerol Stock
cerebellar degeneration-related protein 2-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080929.1-930s21c1
Sequence:CCGGCGCCTACACAGTTCCTCTTTGCTCGAGCAAAGAGGAACTGTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080929.1-857s21c1
Sequence:CCGGACGCAGGAGAACCATCCATACCTCGAGGTATGGATGGTTCTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080929.1-1278s21c1
Sequence:CCGGGGCAGTGGAGATGACTCTAATCTCGAGATTAGAGTCATCTCCACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080929.1-619s21c1
Sequence:CCGGACACACTGAGGCTCGTGAATGCTCGAGCATTCACGAGCCTCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080929.1-3374s21c1
Sequence:CCGGTACCTCCTTCTAATGGGTAAACTCGAGTTTACCCATTAGAAGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080929
VALIDATED
CDR2L MISSION shRNA shRNA Plasmid DNA
cerebellar degeneration-related protein 2-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080929.1-930s21c1
Sequence:CCGGCGCCTACACAGTTCCTCTTTGCTCGAGCAAAGAGGAACTGTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080929.1-857s21c1
Sequence:CCGGACGCAGGAGAACCATCCATACCTCGAGGTATGGATGGTTCTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080929.1-1278s21c1
Sequence:CCGGGGCAGTGGAGATGACTCTAATCTCGAGATTAGAGTCATCTCCACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080929.1-619s21c1
Sequence:CCGGACACACTGAGGCTCGTGAATGCTCGAGCATTCACGAGCCTCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080929.1-3374s21c1
Sequence:CCGGTACCTCCTTCTAATGGGTAAACTCGAGTTTACCCATTAGAAGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080929
VALIDATED
CDR2L MISSION shRNA Lentiviral Transduction Particles
cerebellar degeneration-related protein 2-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080929.1-930s21c1
Sequence:CCGGCGCCTACACAGTTCCTCTTTGCTCGAGCAAAGAGGAACTGTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080929.1-857s21c1
Sequence:CCGGACGCAGGAGAACCATCCATACCTCGAGGTATGGATGGTTCTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080929.1-1278s21c1
Sequence:CCGGGGCAGTGGAGATGACTCTAATCTCGAGATTAGAGTCATCTCCACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080929.1-619s21c1
Sequence:CCGGACACACTGAGGCTCGTGAATGCTCGAGCATTCACGAGCCTCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080929.1-3374s21c1
Sequence:CCGGTACCTCCTTCTAATGGGTAAACTCGAGTTTACCCATTAGAAGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks