EMAIL THIS PAGE TO A FRIEND

CDRT15

CMT1A duplicated region transcript 15

14 Gene Product Result for
Species: Human CDRT15(146822)
UniProtKB ID: Q96T59, B2RUU5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055952 Anti-CDRT15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_085606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_085606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_085606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007530 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007530 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076872 predicted 258
2 SASI_Hs01_00076874 predicted 257
3 SASI_Hs01_00076875 predicted 265
4 SASI_Hs01_00076877 predicted 206
5 SASI_Hs01_00076873 predicted 234
6 SASI_Hs01_00076878 predicted 234
7 SASI_Hs01_00076876 predicted 232
8 SASI_Hs01_00076879 predicted 369
9 SASI_Hs01_00076880 predicted 114
10 SASI_Hs01_00076881 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_085606
CDRT15 MISSION shRNA Bacterial Glycerol Stock
CMT1A duplicated region transcript 15
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000188856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_085606.3-459s1c1
Sequence:CCGGGAAGAAGAGTTCCAGCAGCTACTCGAGTAGCTGCTGGAACTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_085606.3-282s1c1
Sequence:CCGGCTGGTCCATGTGCAGAAGTAACTCGAGTTACTTCTGCACATGGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_085606.3-134s1c1
Sequence:CCGGGTTGTAATAAGGCGCATCCAGCTCGAGCTGGATGCGCCTTATTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_085606
CDRT15 MISSION shRNA shRNA Plasmid DNA
CMT1A duplicated region transcript 15
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000188856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_085606.3-459s1c1
Sequence:CCGGGAAGAAGAGTTCCAGCAGCTACTCGAGTAGCTGCTGGAACTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_085606.3-282s1c1
Sequence:CCGGCTGGTCCATGTGCAGAAGTAACTCGAGTTACTTCTGCACATGGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_085606.3-134s1c1
Sequence:CCGGGTTGTAATAAGGCGCATCCAGCTCGAGCTGGATGCGCCTTATTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_085606
CDRT15 MISSION shRNA Lentiviral Transduction Particles
CMT1A duplicated region transcript 15
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000188856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_085606.3-459s1c1
Sequence:CCGGGAAGAAGAGTTCCAGCAGCTACTCGAGTAGCTGCTGGAACTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_085606.3-282s1c1
Sequence:CCGGCTGGTCCATGTGCAGAAGTAACTCGAGTTACTTCTGCACATGGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_085606.3-134s1c1
Sequence:CCGGGTTGTAATAAGGCGCATCCAGCTCGAGCTGGATGCGCCTTATTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007530
CDRT15 MISSION shRNA Bacterial Glycerol Stock
CMT1A duplicated region transcript 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-107s21c1
Sequence:CCGGGCCTGTCGCCCGTTGTAATAACTCGAGTTATTACAACGGGCGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-385s21c1
Sequence:CCGGACCAACGAGGAGCTGCCTGAACTCGAGTTCAGGCAGCTCCTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-269s21c1
Sequence:CCGGGTCCATGTGCAGAAGTAAGAGCTCGAGCTCTTACTTCTGCACATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-215s21c1
Sequence:CCGGCTGTCCTTGTCCAGGAGATTCCTCGAGGAATCTCCTGGACAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-241s21c1
Sequence:CCGGCTCATTGAGGCACAGACACTTCTCGAGAAGTGTCTGTGCCTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007530
CDRT15 MISSION shRNA shRNA Plasmid DNA
CMT1A duplicated region transcript 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-107s21c1
Sequence:CCGGGCCTGTCGCCCGTTGTAATAACTCGAGTTATTACAACGGGCGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-385s21c1
Sequence:CCGGACCAACGAGGAGCTGCCTGAACTCGAGTTCAGGCAGCTCCTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-269s21c1
Sequence:CCGGGTCCATGTGCAGAAGTAAGAGCTCGAGCTCTTACTTCTGCACATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-215s21c1
Sequence:CCGGCTGTCCTTGTCCAGGAGATTCCTCGAGGAATCTCCTGGACAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-241s21c1
Sequence:CCGGCTCATTGAGGCACAGACACTTCTCGAGAAGTGTCTGTGCCTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007530
CDRT15 MISSION shRNA Lentiviral Transduction Particles
CMT1A duplicated region transcript 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-107s21c1
Sequence:CCGGGCCTGTCGCCCGTTGTAATAACTCGAGTTATTACAACGGGCGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-385s21c1
Sequence:CCGGACCAACGAGGAGCTGCCTGAACTCGAGTTCAGGCAGCTCCTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-269s21c1
Sequence:CCGGGTCCATGTGCAGAAGTAAGAGCTCGAGCTCTTACTTCTGCACATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-215s21c1
Sequence:CCGGCTGTCCTTGTCCAGGAGATTCCTCGAGGAATCTCCTGGACAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007530.1-241s21c1
Sequence:CCGGCTCATTGAGGCACAGACACTTCTCGAGAAGTGTCTGTGCCTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks