EMAIL THIS PAGE TO A FRIEND

CDRT1

CMT1A duplicated region transcript 1

Synonyms: C170RF1 C17ORF1 C17ORF1A FBXW10B FBXW10P1 HREP SM25H2
Species: Human CDRT1(374286)
UniProtKB ID: O95170, O43848, O95611
Gene ID:
Human(374286) Summary: Members of the F-box protein family, such as FBXW10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603034), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006382 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006382 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341444 predicted 1213
2 SASI_Hs02_00341445 predicted 1388
3 SASI_Hs02_00341446 predicted 348
4 SASI_Hs02_00341447 predicted 284
5 SASI_Hs02_00341448 predicted 1048
6 SASI_Hs02_00341449 predicted 2096
7 SASI_Hs02_00341450 predicted 1726
8 SASI_Hs02_00341451 predicted 1221
9 SASI_Hs02_00341452 predicted 1680
10 SASI_Hs02_00341453 predicted 587
11 SASI_Hs01_00176750 predicted 836
12 SASI_Hs01_00176751 predicted 781
13 SASI_Hs01_00176752 predicted 578
14 SASI_Hs01_00176753 predicted 792
15 SASI_Hs01_00176754 predicted 818
16 SASI_Hs01_00176755 predicted 852
17 SASI_Hs01_00176756 predicted 768
18 SASI_Hs01_00176757 predicted 795
19 SASI_Hs01_00176758 predicted 1149
20 SASI_Hs01_00176759 predicted 1248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006382
CDRT1 MISSION shRNA Bacterial Glycerol Stock
CMT1A duplicated region transcript 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-253s1c1
Sequence:CCGGGAGGAAGAGATTGCCAGGTAACTCGAGTTACCTGGCAATCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006382.1-1063s1c1
Sequence:CCGGGAACAGCACAACAAGTGGCAACTCGAGTTGCCACTTGTTGTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-706s1c1
Sequence:CCGGCCTTCTTTATTCAGGGCAACACTCGAGTGTTGCCCTGAATAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-725s1c1
Sequence:CCGGCAGAATTTCAGTCTGCCACATCTCGAGATGTGGCAGACTGAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-302s1c1
Sequence:CCGGCCTGAAGACGTTTAGACACAACTCGAGTTGTGTCTAAACGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-740s1c1
Sequence:CCGGCCACATCAGCACATTTGCTAACTCGAGTTAGCAAATGTGCTGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006382.1-1139s1c1
Sequence:CCGGCCAACTCAACTCAATCATACTCTCGAGAGTATGATTGAGTTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-775s1c1
Sequence:CCGGGATGGAATGGAATCGAACCAACTCGAGTTGGTTCGATTCCATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-340s1c1
Sequence:CCGGCCAGGATCAATGATACCTACACTCGAGTGTAGGTATCATTGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-722s1c1
Sequence:CCGGCAACAGAATTTCAGTCTGCCACTCGAGTGGCAGACTGAAATTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006382
CDRT1 MISSION shRNA shRNA Plasmid DNA
CMT1A duplicated region transcript 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-253s1c1
Sequence:CCGGGAGGAAGAGATTGCCAGGTAACTCGAGTTACCTGGCAATCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006382.1-1063s1c1
Sequence:CCGGGAACAGCACAACAAGTGGCAACTCGAGTTGCCACTTGTTGTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-706s1c1
Sequence:CCGGCCTTCTTTATTCAGGGCAACACTCGAGTGTTGCCCTGAATAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-725s1c1
Sequence:CCGGCAGAATTTCAGTCTGCCACATCTCGAGATGTGGCAGACTGAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-302s1c1
Sequence:CCGGCCTGAAGACGTTTAGACACAACTCGAGTTGTGTCTAAACGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-740s1c1
Sequence:CCGGCCACATCAGCACATTTGCTAACTCGAGTTAGCAAATGTGCTGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006382.1-1139s1c1
Sequence:CCGGCCAACTCAACTCAATCATACTCTCGAGAGTATGATTGAGTTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-775s1c1
Sequence:CCGGGATGGAATGGAATCGAACCAACTCGAGTTGGTTCGATTCCATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-340s1c1
Sequence:CCGGCCAGGATCAATGATACCTACACTCGAGTGTAGGTATCATTGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-722s1c1
Sequence:CCGGCAACAGAATTTCAGTCTGCCACTCGAGTGGCAGACTGAAATTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006382
CDRT1 MISSION shRNA Lentiviral Transduction Particles
CMT1A duplicated region transcript 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-253s1c1
Sequence:CCGGGAGGAAGAGATTGCCAGGTAACTCGAGTTACCTGGCAATCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006382.1-1063s1c1
Sequence:CCGGGAACAGCACAACAAGTGGCAACTCGAGTTGCCACTTGTTGTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-706s1c1
Sequence:CCGGCCTTCTTTATTCAGGGCAACACTCGAGTGTTGCCCTGAATAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-725s1c1
Sequence:CCGGCAGAATTTCAGTCTGCCACATCTCGAGATGTGGCAGACTGAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-302s1c1
Sequence:CCGGCCTGAAGACGTTTAGACACAACTCGAGTTGTGTCTAAACGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-740s1c1
Sequence:CCGGCCACATCAGCACATTTGCTAACTCGAGTTAGCAAATGTGCTGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006382.1-1139s1c1
Sequence:CCGGCCAACTCAACTCAATCATACTCTCGAGAGTATGATTGAGTTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-775s1c1
Sequence:CCGGGATGGAATGGAATCGAACCAACTCGAGTTGGTTCGATTCCATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006382.1-340s1c1
Sequence:CCGGCCAGGATCAATGATACCTACACTCGAGTGTAGGTATCATTGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006382.1-722s1c1
Sequence:CCGGCAACAGAATTTCAGTCTGCCACTCGAGTGGCAGACTGAAATTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks