EMAIL THIS PAGE TO A FRIEND

CDRT4

CMT1A duplicated region transcript 4

58 Gene Product Result for
UniProtKB ID: Q8N9R6, A8MSL9, Q8IZ19
Gene ID:
Mouse(66338) CMT1A duplicated region transcript 4
Rat(100362817) CMT1A duplicated region transcript 4
domestic cat(101092467) CMT1A duplicated region transcript 4
dog(608845) CMT1A duplicated region transcript 4
cow(516149) CMT1A duplicated region transcript 4
domestic guinea pig(100731722) CMT1A duplicated region transcript 4
sheep(101116067) CMT1A duplicated region transcript 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173622 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041921 MISSION® esiRNA esiRNA human CDRT4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173622 Rosetta Predictions human pricing
NM_025496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238725 predicted 605
2 SASI_Hs01_00238726 predicted 555
3 SASI_Hs01_00238727 predicted 359
4 SASI_Hs01_00238728 predicted 554
5 SASI_Hs01_00238729 predicted 627
6 SASI_Hs01_00238730 predicted 711
7 SASI_Hs01_00238731 predicted 628
8 SASI_Hs01_00238732 predicted 721
9 SASI_Hs01_00238733 predicted 620
10 SASI_Hs01_00238734 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026868 predicted 197
2 SASI_Mm01_00026870 predicted 352
3 SASI_Mm01_00026871 predicted 243
4 SASI_Mm02_00328371 predicted 406
5 SASI_Mm02_00328372 predicted 206
6 SASI_Mm02_00328373 predicted 343
7 SASI_Mm01_00026875 predicted 305
8 SASI_Mm01_00026876 predicted 271
9 SASI_Mm02_00328374 predicted 272
10 SASI_Mm02_00328375 predicted 312
11 SASI_Mm01_00026867 predicted 455
12 SASI_Mm01_00026869 predicted 494
13 SASI_Mm01_00026872 predicted 502
14 SASI_Mm01_00026873 predicted 441
15 SASI_Mm01_00026874 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025496
CDRT4 MISSION shRNA Bacterial Glycerol Stock
CMT1A duplicated region transcript 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-205s21c1
Sequence:CCGGACATTGGACTCCCTCTGATACCTCGAGGTATCAGAGGGAGTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-500s21c1
Sequence:CCGGAGAACCTGCACAACTCCAAATCTCGAGATTTGGAGTTGTGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-460s21c1
Sequence:CCGGGGGAATGCTCCACCATATATGCTCGAGCATATATGGTGGAGCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-353s21c1
Sequence:CCGGAGTAAAGCGCAGCAAACATAGCTCGAGCTATGTTTGCTGCGCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-309s21c1
Sequence:CCGGAGGGACCTAGAGTACATTTATCTCGAGATAAATGTACTCTAGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025496.1-277s1c1
Sequence:CCGGCAGTAACCCGAATCACCGAAACTCGAGTTTCGGTGATTCGGGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025496.1-504s1c1
Sequence:CCGGCCTGCACAACTCCAAATGGATCTCGAGATCCATTTGGAGTTGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025496
CDRT4 MISSION shRNA shRNA Plasmid DNA
CMT1A duplicated region transcript 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-205s21c1
Sequence:CCGGACATTGGACTCCCTCTGATACCTCGAGGTATCAGAGGGAGTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-500s21c1
Sequence:CCGGAGAACCTGCACAACTCCAAATCTCGAGATTTGGAGTTGTGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-460s21c1
Sequence:CCGGGGGAATGCTCCACCATATATGCTCGAGCATATATGGTGGAGCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-353s21c1
Sequence:CCGGAGTAAAGCGCAGCAAACATAGCTCGAGCTATGTTTGCTGCGCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-309s21c1
Sequence:CCGGAGGGACCTAGAGTACATTTATCTCGAGATAAATGTACTCTAGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025496.1-277s1c1
Sequence:CCGGCAGTAACCCGAATCACCGAAACTCGAGTTTCGGTGATTCGGGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025496.1-504s1c1
Sequence:CCGGCCTGCACAACTCCAAATGGATCTCGAGATCCATTTGGAGTTGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025496
CDRT4 MISSION shRNA Lentiviral Transduction Particles
CMT1A duplicated region transcript 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-205s21c1
Sequence:CCGGACATTGGACTCCCTCTGATACCTCGAGGTATCAGAGGGAGTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-500s21c1
Sequence:CCGGAGAACCTGCACAACTCCAAATCTCGAGATTTGGAGTTGTGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-460s21c1
Sequence:CCGGGGGAATGCTCCACCATATATGCTCGAGCATATATGGTGGAGCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-353s21c1
Sequence:CCGGAGTAAAGCGCAGCAAACATAGCTCGAGCTATGTTTGCTGCGCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025496.1-309s21c1
Sequence:CCGGAGGGACCTAGAGTACATTTATCTCGAGATAAATGTACTCTAGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025496.1-277s1c1
Sequence:CCGGCAGTAACCCGAATCACCGAAACTCGAGTTTCGGTGATTCGGGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025496.1-504s1c1
Sequence:CCGGCCTGCACAACTCCAAATGGATCTCGAGATCCATTTGGAGTTGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173622
CDRT4 MISSION shRNA Bacterial Glycerol Stock
CMT1A duplicated region transcript 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-399s1c1
Sequence:CCGGCCAGAGACTGTCCAACTGAAACTCGAGTTTCAGTTGGACAGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-226s1c1
Sequence:CCGGGAATAAACCTTCCAGCGTCATCTCGAGATGACGCTGGAAGGTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-334s1c1
Sequence:CCGGCGCTTATTCGGTATTGGCCATCTCGAGATGGCCAATACCGAATAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-215s1c1
Sequence:CCGGGCATCAAGGCAGAATAAACCTCTCGAGAGGTTTATTCTGCCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-427s1c1
Sequence:CCGGCAAGATCATCTTTGCCCGCAACTCGAGTTGCGGGCAAAGATGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-371s1c1
Sequence:CCGGCCAGAACCCACACACTTACATCTCGAGATGTAAGTGTGTGGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-395s1c1
Sequence:CCGGGATTCCAGAGACTGTCCAACTCTCGAGAGTTGGACAGTCTCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-116s1c1
Sequence:CCGGGCCTATGTCACCTATACCTCTCTCGAGAGAGGTATAGGTGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-450s1c1
Sequence:CCGGCTATGATGAGGATGCTCCCTACTCGAGTAGGGAGCATCCTCATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173622
CDRT4 MISSION shRNA shRNA Plasmid DNA
CMT1A duplicated region transcript 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-399s1c1
Sequence:CCGGCCAGAGACTGTCCAACTGAAACTCGAGTTTCAGTTGGACAGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-226s1c1
Sequence:CCGGGAATAAACCTTCCAGCGTCATCTCGAGATGACGCTGGAAGGTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-334s1c1
Sequence:CCGGCGCTTATTCGGTATTGGCCATCTCGAGATGGCCAATACCGAATAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-215s1c1
Sequence:CCGGGCATCAAGGCAGAATAAACCTCTCGAGAGGTTTATTCTGCCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-427s1c1
Sequence:CCGGCAAGATCATCTTTGCCCGCAACTCGAGTTGCGGGCAAAGATGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-371s1c1
Sequence:CCGGCCAGAACCCACACACTTACATCTCGAGATGTAAGTGTGTGGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-395s1c1
Sequence:CCGGGATTCCAGAGACTGTCCAACTCTCGAGAGTTGGACAGTCTCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-116s1c1
Sequence:CCGGGCCTATGTCACCTATACCTCTCTCGAGAGAGGTATAGGTGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-450s1c1
Sequence:CCGGCTATGATGAGGATGCTCCCTACTCGAGTAGGGAGCATCCTCATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173622
CDRT4 MISSION shRNA Lentiviral Transduction Particles
CMT1A duplicated region transcript 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-399s1c1
Sequence:CCGGCCAGAGACTGTCCAACTGAAACTCGAGTTTCAGTTGGACAGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-226s1c1
Sequence:CCGGGAATAAACCTTCCAGCGTCATCTCGAGATGACGCTGGAAGGTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-334s1c1
Sequence:CCGGCGCTTATTCGGTATTGGCCATCTCGAGATGGCCAATACCGAATAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-215s1c1
Sequence:CCGGGCATCAAGGCAGAATAAACCTCTCGAGAGGTTTATTCTGCCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-427s1c1
Sequence:CCGGCAAGATCATCTTTGCCCGCAACTCGAGTTGCGGGCAAAGATGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-371s1c1
Sequence:CCGGCCAGAACCCACACACTTACATCTCGAGATGTAAGTGTGTGGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173622.1-395s1c1
Sequence:CCGGGATTCCAGAGACTGTCCAACTCTCGAGAGTTGGACAGTCTCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-116s1c1
Sequence:CCGGGCCTATGTCACCTATACCTCTCTCGAGAGAGGTATAGGTGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173622.1-450s1c1
Sequence:CCGGCTATGATGAGGATGCTCCCTACTCGAGTAGGGAGCATCCTCATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks