EMAIL THIS PAGE TO A FRIEND

CDS1

CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1

59 Gene Product Result for
Synonyms: CDS
UniProtKB ID: Q92903, B2RAL5, O00163
Gene ID:
Human(1040) Summary: Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
Mouse(74596) CDP-diacylglycerol synthase 1
Rat(81925) CDP-diacylglycerol synthase 1
Zebrafish(100002015) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
cow(100336936) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
Horse(100052434) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
domestic cat(101082147) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
dog(487840) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
chicken(422611) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
Thale Cress(842541) phosphatidate cytidylyltransferase
sheep(101110414) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
Domestic Rabbit(100354125) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
domestic guinea pig(100719319) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
naked mole-rat(101726280) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001263 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032981 MISSION® esiRNA esiRNA human CDS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001263 Rosetta Predictions human pricing
NM_031242 Rosetta Predictions rat pricing
NM_173370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091116 predicted 888
2 SASI_Hs02_00331454 predicted 1524
3 SASI_Hs01_00091117 predicted 643
4 SASI_Hs01_00091119 predicted 921
5 SASI_Hs02_00331455 predicted 1471
6 SASI_Hs02_00331456 predicted 855
7 SASI_Hs01_00091120 predicted 1021
8 SASI_Hs01_00091121 predicted 879
9 SASI_Hs01_00091122 predicted 1010
10 SASI_Hs01_00091123 predicted 1893
11 SASI_Hs01_00091115 predicted 1833
12 SASI_Hs01_00091118 predicted 850
13 SASI_Hs01_00091124 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264529 predicted 1122
2 SASI_Rn01_00090858 predicted 539
3 SASI_Rn02_00264530 predicted 1364
4 SASI_Rn02_00264531 predicted 1130
5 SASI_Rn01_00090857 predicted 1572
6 SASI_Rn01_00090862 predicted 1553
7 SASI_Rn01_00090863 predicted 1703
8 SASI_Rn01_00090866 predicted 1553
9 SASI_Rn02_00264532 predicted 1670
10 SASI_Rn02_00264533 predicted 339
11 SASI_Rn01_00090859 predicted 1520
12 SASI_Rn01_00090860 predicted 1655
13 SASI_Rn01_00090861 predicted 468
14 SASI_Rn01_00090864 predicted 1322
15 SASI_Rn01_00090865 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122172 predicted 724
2 SASI_Mm01_00122173 predicted 1520
3 SASI_Mm01_00122174 predicted 1435
4 SASI_Mm01_00122175 predicted 1309
5 SASI_Mm01_00122176 predicted 349
6 SASI_Mm01_00122177 predicted 1224
7 SASI_Mm01_00122178 predicted 1457
8 SASI_Mm01_00122179 predicted 1708
9 SASI_Mm01_00122180 predicted 360
10 SASI_Mm01_00122181 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001263
CDS1 MISSION shRNA Bacterial Glycerol Stock
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-1365s1c1
Sequence:CCGGGCTGCCTATGTGTTATCCAAACTCGAGTTTGGATAACACATAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-850s1c1
Sequence:CCGGGCTTCCATGAAATTATCACTACTCGAGTAGTGATAATTTCATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-592s1c1
Sequence:CCGGCCAGCGACAAAGAAACAGATACTCGAGTATCTGTTTCTTTGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-1788s1c1
Sequence:CCGGCCTGAACAGCAGTTAAATATACTCGAGTATATTTAACTGCTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001263.3-926s21c1
Sequence:CCGGGAACACTAAGTTGGTACTTTCCTCGAGGAAAGTACCAACTTAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001263.3-1864s21c1
Sequence:CCGGCAACCCACCTTGAAGGTATAACTCGAGTTATACCTTCAAGGTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001263.3-661s21c1
Sequence:CCGGGATTCTGATATTCCGGAAATTCTCGAGAATTTCCGGAATATCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001263
CDS1 MISSION shRNA shRNA Plasmid DNA
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-1365s1c1
Sequence:CCGGGCTGCCTATGTGTTATCCAAACTCGAGTTTGGATAACACATAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-850s1c1
Sequence:CCGGGCTTCCATGAAATTATCACTACTCGAGTAGTGATAATTTCATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-592s1c1
Sequence:CCGGCCAGCGACAAAGAAACAGATACTCGAGTATCTGTTTCTTTGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-1788s1c1
Sequence:CCGGCCTGAACAGCAGTTAAATATACTCGAGTATATTTAACTGCTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001263.3-926s21c1
Sequence:CCGGGAACACTAAGTTGGTACTTTCCTCGAGGAAAGTACCAACTTAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001263.3-1864s21c1
Sequence:CCGGCAACCCACCTTGAAGGTATAACTCGAGTTATACCTTCAAGGTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001263.3-661s21c1
Sequence:CCGGGATTCTGATATTCCGGAAATTCTCGAGAATTTCCGGAATATCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001263
CDS1 MISSION shRNA Lentiviral Transduction Particles
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-1365s1c1
Sequence:CCGGGCTGCCTATGTGTTATCCAAACTCGAGTTTGGATAACACATAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-850s1c1
Sequence:CCGGGCTTCCATGAAATTATCACTACTCGAGTAGTGATAATTTCATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-592s1c1
Sequence:CCGGCCAGCGACAAAGAAACAGATACTCGAGTATCTGTTTCTTTGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001263.2-1788s1c1
Sequence:CCGGCCTGAACAGCAGTTAAATATACTCGAGTATATTTAACTGCTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001263.3-926s21c1
Sequence:CCGGGAACACTAAGTTGGTACTTTCCTCGAGGAAAGTACCAACTTAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001263.3-1864s21c1
Sequence:CCGGCAACCCACCTTGAAGGTATAACTCGAGTTATACCTTCAAGGTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001263.3-661s21c1
Sequence:CCGGGATTCTGATATTCCGGAAATTCTCGAGAATTTCCGGAATATCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173370
CDS1 MISSION shRNA Bacterial Glycerol Stock
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173370.3-1825s1c1
Sequence:CCGGCCGTGAAAGATCCTGTACTTTCTCGAGAAAGTACAGGATCTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-474s1c1
Sequence:CCGGCGGACTATCTTCAAGATGGAACTCGAGTTCCATCTTGAAGATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-538s1c1
Sequence:CCGGCTCTTCTTCCTGATTATCTATCTCGAGATAGATAATCAGGAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-1402s1c1
Sequence:CCGGGCAAACACGATTCCTGGACATCTCGAGATGTCCAGGAATCGTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-730s1c1
Sequence:CCGGGCAGATTACTTCGCCACGTTTCTCGAGAAACGTGGCGAAGTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173370
CDS1 MISSION shRNA shRNA Plasmid DNA
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173370.3-1825s1c1
Sequence:CCGGCCGTGAAAGATCCTGTACTTTCTCGAGAAAGTACAGGATCTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-474s1c1
Sequence:CCGGCGGACTATCTTCAAGATGGAACTCGAGTTCCATCTTGAAGATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-538s1c1
Sequence:CCGGCTCTTCTTCCTGATTATCTATCTCGAGATAGATAATCAGGAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-1402s1c1
Sequence:CCGGGCAAACACGATTCCTGGACATCTCGAGATGTCCAGGAATCGTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-730s1c1
Sequence:CCGGGCAGATTACTTCGCCACGTTTCTCGAGAAACGTGGCGAAGTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173370
CDS1 MISSION shRNA Lentiviral Transduction Particles
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173370.3-1825s1c1
Sequence:CCGGCCGTGAAAGATCCTGTACTTTCTCGAGAAAGTACAGGATCTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-474s1c1
Sequence:CCGGCGGACTATCTTCAAGATGGAACTCGAGTTCCATCTTGAAGATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-538s1c1
Sequence:CCGGCTCTTCTTCCTGATTATCTATCTCGAGATAGATAATCAGGAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-1402s1c1
Sequence:CCGGGCAAACACGATTCCTGGACATCTCGAGATGTCCAGGAATCGTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173370.3-730s1c1
Sequence:CCGGGCAGATTACTTCGCCACGTTTCTCGAGAAACGTGGCGAAGTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks