EMAIL THIS PAGE TO A FRIEND

CDS2

CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2

101 Gene Product Result for
Gene ID:
Human(8760) Summary: Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
Mouse(110911) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Rat(114101) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
naked mole-rat(101714337) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
domestic guinea pig(100734378) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
sheep(101114631) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Zebrafish(394161) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Thale Cress(828329) cytidinediphosphate diacylglycerol synthase 2
chicken(419517) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
dog(485780) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
cow(614834) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
domestic cat(101088071) CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003818 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003818 Rosetta Predictions human pricing
NM_053643 Rosetta Predictions rat pricing
NM_138651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037639 predicted 645
2 SASI_Hs01_00037640 predicted 893
3 SASI_Hs01_00037641 predicted 758
4 SASI_Hs01_00037642 predicted 691
5 SASI_Hs01_00037643 predicted 1324
6 SASI_Hs01_00037644 predicted 639
7 SASI_Hs01_00037645 predicted 856
8 SASI_Hs01_00037646 predicted 612
9 SASI_Hs01_00037647 predicted 909
10 SASI_Hs01_00037648 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120425 predicted 570
2 SASI_Rn01_00120426 predicted 779
3 SASI_Rn01_00120427 predicted 1252
4 SASI_Rn01_00120428 predicted 578
5 SASI_Rn01_00120429 predicted 606
6 SASI_Rn01_00120430 predicted 373
7 SASI_Rn01_00120431 predicted 596
8 SASI_Rn01_00120432 predicted 1066
9 SASI_Rn01_00120433 predicted 744
10 SASI_Rn01_00120434 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339702 predicted 506
2 SASI_Mm02_00339703 predicted 715
3 SASI_Mm02_00339704 predicted 487
4 SASI_Mm02_00339705 predicted 812
5 SASI_Mm02_00339706 predicted 887
6 SASI_Mm02_00339707 predicted 1174
7 SASI_Mm02_00339708 predicted 1359
8 SASI_Mm02_00339709 predicted 237
9 SASI_Mm02_00339710 predicted 821
10 SASI_Mm02_00339711 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003818
VALIDATED
CDS2 MISSION shRNA Bacterial Glycerol Stock
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-959s21c1
Sequence:CCGGTAATGACATCATGGCCTATATCTCGAGATATAGGCCATGATGTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-1309s21c1
Sequence:CCGGCCTTTGGAGGATTCTTCGCAACTCGAGTTGCGAAGAATCCTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-597s21c1
Sequence:CCGGTACAACGTCTACCACTCATATCTCGAGATATGAGTGGTAGACGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-656s21c1
Sequence:CCGGCCTGTGTGTAAACTATTTCTTCTCGAGAAGAAATAGTTTACACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-729s21c1
Sequence:CCGGCCTTTGCGGATTCTCAGTAAACTCGAGTTTACTGAGAATCCGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003818.2-1542s1c1
Sequence:CCGGCGGTCTCATCTGATCGACAAACTCGAGTTTGTCGATCAGATGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003818.2-729s1c1
Sequence:CCGGCCTTTGCGGATTCTCAGTAAACTCGAGTTTACTGAGAATCCGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003818.2-1309s1c1
Sequence:CCGGCCTTTGGAGGATTCTTCGCAACTCGAGTTGCGAAGAATCCTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003818.2-656s1c1
Sequence:CCGGCCTGTGTGTAAACTATTTCTTCTCGAGAAGAAATAGTTTACACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003818.2-902s1c1
Sequence:CCGGCCACAACCTATTTGAAGGAATCTCGAGATTCCTTCAAATAGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003818
VALIDATED
CDS2 MISSION shRNA shRNA Plasmid DNA
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-959s21c1
Sequence:CCGGTAATGACATCATGGCCTATATCTCGAGATATAGGCCATGATGTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-1309s21c1
Sequence:CCGGCCTTTGGAGGATTCTTCGCAACTCGAGTTGCGAAGAATCCTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-597s21c1
Sequence:CCGGTACAACGTCTACCACTCATATCTCGAGATATGAGTGGTAGACGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-656s21c1
Sequence:CCGGCCTGTGTGTAAACTATTTCTTCTCGAGAAGAAATAGTTTACACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-729s21c1
Sequence:CCGGCCTTTGCGGATTCTCAGTAAACTCGAGTTTACTGAGAATCCGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003818.2-1542s1c1
Sequence:CCGGCGGTCTCATCTGATCGACAAACTCGAGTTTGTCGATCAGATGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003818.2-729s1c1
Sequence:CCGGCCTTTGCGGATTCTCAGTAAACTCGAGTTTACTGAGAATCCGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003818.2-1309s1c1
Sequence:CCGGCCTTTGGAGGATTCTTCGCAACTCGAGTTGCGAAGAATCCTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003818.2-656s1c1
Sequence:CCGGCCTGTGTGTAAACTATTTCTTCTCGAGAAGAAATAGTTTACACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003818.2-902s1c1
Sequence:CCGGCCACAACCTATTTGAAGGAATCTCGAGATTCCTTCAAATAGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003818
VALIDATED
CDS2 MISSION shRNA Lentiviral Transduction Particles
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-959s21c1
Sequence:CCGGTAATGACATCATGGCCTATATCTCGAGATATAGGCCATGATGTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-1309s21c1
Sequence:CCGGCCTTTGGAGGATTCTTCGCAACTCGAGTTGCGAAGAATCCTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-597s21c1
Sequence:CCGGTACAACGTCTACCACTCATATCTCGAGATATGAGTGGTAGACGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-656s21c1
Sequence:CCGGCCTGTGTGTAAACTATTTCTTCTCGAGAAGAAATAGTTTACACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003818.2-729s21c1
Sequence:CCGGCCTTTGCGGATTCTCAGTAAACTCGAGTTTACTGAGAATCCGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003818.2-1542s1c1
Sequence:CCGGCGGTCTCATCTGATCGACAAACTCGAGTTTGTCGATCAGATGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003818.2-729s1c1
Sequence:CCGGCCTTTGCGGATTCTCAGTAAACTCGAGTTTACTGAGAATCCGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003818.2-1309s1c1
Sequence:CCGGCCTTTGGAGGATTCTTCGCAACTCGAGTTGCGAAGAATCCTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003818.2-656s1c1
Sequence:CCGGCCTGTGTGTAAACTATTTCTTCTCGAGAAGAAATAGTTTACACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003818.2-902s1c1
Sequence:CCGGCCACAACCTATTTGAAGGAATCTCGAGATTCCTTCAAATAGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138651
CDS2 MISSION shRNA Bacterial Glycerol Stock
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138651.6-732s21c1
Sequence:CCGGTGAGTCTAGTTAAGAAGCATTCTCGAGAATGCTTCTTAACTAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138651.6-1257s21c1
Sequence:CCGGGTGGATTCAAACGGGCCTTTACTCGAGTAAAGGCCCGTTTGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138651.6-3720s21c1
Sequence:CCGGGCGTGTTGTTTGTTCCAGTAACTCGAGTTACTGGAACAAACAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138651.6-755s21c1
Sequence:CCGGCGGCTGCAGTTCTACATGTTTCTCGAGAAACATGTAGAACTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138651.2-3680s1c1
Sequence:CCGGGCGTGTTGTTTGTTCCAGTAACTCGAGTTACTGGAACAAACAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-627s1c1
Sequence:CCGGCCTCAGTAAATACCACCGGTTCTCGAGAACCGGTGGTATTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-715s1c1
Sequence:CCGGCGGCTGCAGTTCTACATGTTTCTCGAGAAACATGTAGAACTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-692s1c1
Sequence:CCGGTGAGTCTAGTTAAGAAGCATTCTCGAGAATGCTTCTTAACTAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-1217s1c1
Sequence:CCGGGTGGATTCAAACGGGCCTTTACTCGAGTAAAGGCCCGTTTGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138651
CDS2 MISSION shRNA shRNA Plasmid DNA
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138651.6-732s21c1
Sequence:CCGGTGAGTCTAGTTAAGAAGCATTCTCGAGAATGCTTCTTAACTAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138651.6-1257s21c1
Sequence:CCGGGTGGATTCAAACGGGCCTTTACTCGAGTAAAGGCCCGTTTGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138651.6-3720s21c1
Sequence:CCGGGCGTGTTGTTTGTTCCAGTAACTCGAGTTACTGGAACAAACAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138651.6-755s21c1
Sequence:CCGGCGGCTGCAGTTCTACATGTTTCTCGAGAAACATGTAGAACTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138651.2-3680s1c1
Sequence:CCGGGCGTGTTGTTTGTTCCAGTAACTCGAGTTACTGGAACAAACAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-627s1c1
Sequence:CCGGCCTCAGTAAATACCACCGGTTCTCGAGAACCGGTGGTATTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-715s1c1
Sequence:CCGGCGGCTGCAGTTCTACATGTTTCTCGAGAAACATGTAGAACTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-692s1c1
Sequence:CCGGTGAGTCTAGTTAAGAAGCATTCTCGAGAATGCTTCTTAACTAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-1217s1c1
Sequence:CCGGGTGGATTCAAACGGGCCTTTACTCGAGTAAAGGCCCGTTTGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138651
CDS2 MISSION shRNA Lentiviral Transduction Particles
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138651.6-732s21c1
Sequence:CCGGTGAGTCTAGTTAAGAAGCATTCTCGAGAATGCTTCTTAACTAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138651.6-1257s21c1
Sequence:CCGGGTGGATTCAAACGGGCCTTTACTCGAGTAAAGGCCCGTTTGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138651.6-3720s21c1
Sequence:CCGGGCGTGTTGTTTGTTCCAGTAACTCGAGTTACTGGAACAAACAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138651.6-755s21c1
Sequence:CCGGCGGCTGCAGTTCTACATGTTTCTCGAGAAACATGTAGAACTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138651.2-3680s1c1
Sequence:CCGGGCGTGTTGTTTGTTCCAGTAACTCGAGTTACTGGAACAAACAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-627s1c1
Sequence:CCGGCCTCAGTAAATACCACCGGTTCTCGAGAACCGGTGGTATTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-715s1c1
Sequence:CCGGCGGCTGCAGTTCTACATGTTTCTCGAGAAACATGTAGAACTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-692s1c1
Sequence:CCGGTGAGTCTAGTTAAGAAGCATTCTCGAGAATGCTTCTTAACTAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138651.2-1217s1c1
Sequence:CCGGGTGGATTCAAACGGGCCTTTACTCGAGTAAAGGCCCGTTTGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks