EMAIL THIS PAGE TO A FRIEND

CDSN

corneodesmosin

67 Gene Product Result for
Synonyms: D6S586E HTSS HTSS1 PSS S
Gene ID:
Human(1041) Summary: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. During maturation of the cornified layers, the protein undergoes a series of cleavages, which are thought to be required for desquamation. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(386463) corneodesmosin
Rat(406198) corneodesmosin
dog(607062) corneodesmosin
domestic cat(101097973) corneodesmosin
cow(522351) corneodesmosin
sheep(101109128) corneodesmosin
naked mole-rat(101726009) corneodesmosin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001264 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001008424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225551 MISSION® esiRNA esiRNA targeting human CDSN human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001264 Rosetta Predictions human pricing
NM_001008424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117208 predicted 1590
2 SASI_Hs01_00117209 predicted 1919
3 SASI_Hs01_00117210 predicted 875
4 SASI_Hs01_00117211 predicted 1644
5 SASI_Hs02_00331457 predicted 1998
6 SASI_Hs01_00117213 predicted 1614
7 SASI_Hs01_00117214 predicted 1815
8 SASI_Hs02_00331458 predicted 2080
9 SASI_Hs01_00117216 predicted 1518
10 SASI_Hs01_00117217 predicted 939
11 SASI_Hs01_00117212 predicted 2039
12 SASI_Hs01_00117215 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286790 predicted 1546
2 SASI_Mm02_00286791 predicted 225
3 SASI_Mm01_00154281 predicted 727
4 SASI_Mm01_00154282 predicted 1189
5 SASI_Mm01_00154283 predicted 1061
6 SASI_Mm02_00286792 predicted 383
7 SASI_Mm02_00286793 predicted 1738
8 SASI_Mm02_00286794 predicted 1643
9 SASI_Mm02_00286795 predicted 723
10 SASI_Mm02_00286796 predicted 217
11 SASI_Mm01_00154277 predicted 933
12 SASI_Mm01_00154278 predicted 1744
13 SASI_Mm01_00154279 predicted 1546
14 SASI_Mm01_00154280 predicted 886
15 SASI_Mm01_00154284 predicted 697
16 SASI_Mm01_00154285 predicted 911
17 SASI_Mm01_00154286 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001264
CDSN MISSION shRNA Bacterial Glycerol Stock
corneodesmosin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001264.2-1644s1c1
Sequence:CCGGGCACATACACTATATCCCATACTCGAGTATGGGATATAGTGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-542s1c1
Sequence:CCGGGCCAACCAATGACAACTCTTACTCGAGTAAGAGTTGTCATTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-379s1c1
Sequence:CCGGGCTCTAGTCTACAAGGTGCATCTCGAGATGCACCTTGTAGACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-938s1c1
Sequence:CCGGTCCAGGCATGACCTACAGTAACTCGAGTTACTGTAGGTCATGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-866s1c1
Sequence:CCGGCCCAATCACCTCTGTAGACAACTCGAGTTGTCTACAGAGGTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001264.3-1995s21c1
Sequence:CCGGCTGACGCCTGAAGAAGTTATACTCGAGTATAACTTCTTCAGGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001264.3-1610s21c1
Sequence:CCGGGTCCATAAGAAGTCAACTGTTCTCGAGAACAGTTGACTTCTTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001264.3-1702s21c1
Sequence:CCGGGCATAGGGTTAGCTCAGTTTCCTCGAGGAAACTGAGCTAACCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001264
CDSN MISSION shRNA shRNA Plasmid DNA
corneodesmosin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001264.2-1644s1c1
Sequence:CCGGGCACATACACTATATCCCATACTCGAGTATGGGATATAGTGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-542s1c1
Sequence:CCGGGCCAACCAATGACAACTCTTACTCGAGTAAGAGTTGTCATTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-379s1c1
Sequence:CCGGGCTCTAGTCTACAAGGTGCATCTCGAGATGCACCTTGTAGACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-938s1c1
Sequence:CCGGTCCAGGCATGACCTACAGTAACTCGAGTTACTGTAGGTCATGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-866s1c1
Sequence:CCGGCCCAATCACCTCTGTAGACAACTCGAGTTGTCTACAGAGGTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001264.3-1995s21c1
Sequence:CCGGCTGACGCCTGAAGAAGTTATACTCGAGTATAACTTCTTCAGGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001264.3-1610s21c1
Sequence:CCGGGTCCATAAGAAGTCAACTGTTCTCGAGAACAGTTGACTTCTTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001264.3-1702s21c1
Sequence:CCGGGCATAGGGTTAGCTCAGTTTCCTCGAGGAAACTGAGCTAACCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001264
CDSN MISSION shRNA Lentiviral Transduction Particles
corneodesmosin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001264.2-1644s1c1
Sequence:CCGGGCACATACACTATATCCCATACTCGAGTATGGGATATAGTGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-542s1c1
Sequence:CCGGGCCAACCAATGACAACTCTTACTCGAGTAAGAGTTGTCATTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-379s1c1
Sequence:CCGGGCTCTAGTCTACAAGGTGCATCTCGAGATGCACCTTGTAGACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-938s1c1
Sequence:CCGGTCCAGGCATGACCTACAGTAACTCGAGTTACTGTAGGTCATGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001264.2-866s1c1
Sequence:CCGGCCCAATCACCTCTGTAGACAACTCGAGTTGTCTACAGAGGTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001264.3-1995s21c1
Sequence:CCGGCTGACGCCTGAAGAAGTTATACTCGAGTATAACTTCTTCAGGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001264.3-1610s21c1
Sequence:CCGGGTCCATAAGAAGTCAACTGTTCTCGAGAACAGTTGACTTCTTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001264.3-1702s21c1
Sequence:CCGGGCATAGGGTTAGCTCAGTTTCCTCGAGGAAACTGAGCTAACCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008424
VALIDATED
CDSN MISSION shRNA Bacterial Glycerol Stock
corneodesmosin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008424.1-139s1c1
Sequence:CCGGCGGTCTTATTCTGCCAGGAATCTCGAGATTCCTGGCAGAATAAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008424.1-1550s1c1
Sequence:CCGGCCATTGAATGGTGGTCTGAATCTCGAGATTCAGACCACCATTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008424.1-1734s1c1
Sequence:CCGGGAGAGCCACTTGAGAAGTCTTCTCGAGAAGACTTCTCAAGTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-1739s21c1
Sequence:CCGGGAGCCACTTGAGAAGTCTTAACTCGAGTTAAGACTTCTCAAGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-130s21c1
Sequence:CCGGATTGCTGATGGCCGGTCTTATCTCGAGATAAGACCGGCCATCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-359s21c1
Sequence:CCGGTCTTCAGGATCCTTGATATATCTCGAGATATATCAAGGATCCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-1052s21c1
Sequence:CCGGGGTGGCTCTGCCAACAGTTATCTCGAGATAACTGTTGGCAGAGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008424.2-2401s21c1
Sequence:CCGGGGACTTTGTGCAGACTATTTGCTCGAGCAAATAGTCTGCACAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008424
VALIDATED
CDSN MISSION shRNA shRNA Plasmid DNA
corneodesmosin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008424.1-139s1c1
Sequence:CCGGCGGTCTTATTCTGCCAGGAATCTCGAGATTCCTGGCAGAATAAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008424.1-1550s1c1
Sequence:CCGGCCATTGAATGGTGGTCTGAATCTCGAGATTCAGACCACCATTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008424.1-1734s1c1
Sequence:CCGGGAGAGCCACTTGAGAAGTCTTCTCGAGAAGACTTCTCAAGTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-1739s21c1
Sequence:CCGGGAGCCACTTGAGAAGTCTTAACTCGAGTTAAGACTTCTCAAGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-130s21c1
Sequence:CCGGATTGCTGATGGCCGGTCTTATCTCGAGATAAGACCGGCCATCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-359s21c1
Sequence:CCGGTCTTCAGGATCCTTGATATATCTCGAGATATATCAAGGATCCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-1052s21c1
Sequence:CCGGGGTGGCTCTGCCAACAGTTATCTCGAGATAACTGTTGGCAGAGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008424.2-2401s21c1
Sequence:CCGGGGACTTTGTGCAGACTATTTGCTCGAGCAAATAGTCTGCACAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008424
VALIDATED
CDSN MISSION shRNA Lentiviral Transduction Particles
corneodesmosin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008424.1-139s1c1
Sequence:CCGGCGGTCTTATTCTGCCAGGAATCTCGAGATTCCTGGCAGAATAAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008424.1-1550s1c1
Sequence:CCGGCCATTGAATGGTGGTCTGAATCTCGAGATTCAGACCACCATTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008424.1-1734s1c1
Sequence:CCGGGAGAGCCACTTGAGAAGTCTTCTCGAGAAGACTTCTCAAGTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-1739s21c1
Sequence:CCGGGAGCCACTTGAGAAGTCTTAACTCGAGTTAAGACTTCTCAAGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-130s21c1
Sequence:CCGGATTGCTGATGGCCGGTCTTATCTCGAGATAAGACCGGCCATCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-359s21c1
Sequence:CCGGTCTTCAGGATCCTTGATATATCTCGAGATATATCAAGGATCCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001008424.2-1052s21c1
Sequence:CCGGGGTGGCTCTGCCAACAGTTATCTCGAGATAACTGTTGGCAGAGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008424.2-2401s21c1
Sequence:CCGGGGACTTTGTGCAGACTATTTGCTCGAGCAAATAGTCTGCACAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks