EMAIL THIS PAGE TO A FRIEND

CDT1

chromatin licensing and DNA replication factor 1

47 Gene Product Result for
Synonyms: DUP RIS2
Gene ID:
Human(81620) Summary: The protein encoded by this gene is involved in the formation of the pre-replication complex that is necessary for DNA replication. The encoded protein can bind geminin, which prevents replication and may function to prevent this protein from initiating replication at inappropriate origins. Phosphorylation of this protein by cyclin A-dependent kinases results in degradation of the protein. [provided by RefSeq, Mar 2011]
Mouse(67177) chromatin licensing and DNA replication factor 1
Rat(292071) chromatin licensing and DNA replication factor 1
Zebrafish(566787) chromatin licensing and DNA replication factor 1
Thale Cress(2745823) cadmium tolerance 1
chicken(426254) chromatin licensing and DNA replication factor 1
domestic cat(101098673) chromatin licensing and DNA replication factor 1
cow(519016) chromatin licensing and DNA replication factor 1
Horse(100051139) chromatin licensing and DNA replication factor 1
dog(479616) chromatin licensing and DNA replication factor 1
naked mole-rat(101714018) chromatin licensing and DNA replication factor 1
domestic guinea pig(100733165) chromatin licensing and DNA replication factor 1
sheep(101108074) chromatin licensing and DNA replication factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030928 Rosetta Predictions human pricing
NM_001106192 Rosetta Predictions rat pricing
NM_026014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047763 predicted 720
2 SASI_Hs02_00358488 predicted 1050
3 SASI_Hs01_00047761 predicted 601
4 SASI_Hs01_00047762 predicted 1768
5 SASI_Hs01_00047764 predicted 1436
6 SASI_Hs01_00047765 predicted 774
7 SASI_Hs01_00047766 predicted 783
8 SASI_Hs02_00358489 predicted 718
9 SASI_Hs01_00047768 predicted 544
10 SASI_Hs01_00047769 predicted 630
11 SASI_Hs01_00047760 predicted 751
12 SASI_Hs01_00047767 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216538 predicted 1754
2 SASI_Rn02_00216539 predicted 1913
3 SASI_Rn02_00216540 predicted 768
4 SASI_Rn02_00216541 predicted 1167
5 SASI_Rn02_00216542 predicted 980
6 SASI_Rn02_00216543 predicted 551
7 SASI_Rn02_00216544 predicted 858
8 SASI_Rn02_00216545 predicted 367
9 SASI_Rn02_00216546 predicted 837
10 SASI_Rn02_00216547 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201286 predicted 774
2 SASI_Mm01_00201287 predicted 633
3 SASI_Mm01_00201288 predicted 377
4 SASI_Mm01_00201289 predicted 1756
5 SASI_Mm01_00201290 predicted 1807
6 SASI_Mm01_00201291 predicted 381
7 SASI_Mm01_00201292 predicted 1754
8 SASI_Mm01_00201293 predicted 1493
9 SASI_Mm01_00201294 predicted 678
10 SASI_Mm02_00329482 predicted 726
11 SASI_Mm01_00201295 predicted 865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030928
CDT1 MISSION shRNA Bacterial Glycerol Stock
chromatin licensing and DNA replication factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030928.3-966s21c1
Sequence:CCGGGCATGTCAAGGAGCACCACAACTCGAGTTGTGGTGCTCCTTGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030928.2-754s1c2
Sequence:CCGGCGCAATGTTGGCCAGATCAAACTCGAGTTTGATCTGGCCAACATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030928.3-1891s21c1
Sequence:CCGGACCTGGTGGATTCACATTAAACTCGAGTTTAATGTGAATCCACCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030928.3-2064s21c1
Sequence:CCGGTAATCTTGGAACCTCTGAATACTCGAGTATTCAGAGGTTCCAAGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030928.3-1609s21c1
Sequence:CCGGACCTACGTCAAGCTGGACAAGCTCGAGCTTGTCCAGCTTGACGTAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030928.3-1765s21c1
Sequence:CCGGTTATGAACATGATACACTTTGCTCGAGCAAAGTGTATCATGTTCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073298    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_030928.2-2636s1c1
Sequence:CCGGGACCTCCTAAACTCTAATAAACTCGAGTTTATTAGAGTTTAGGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030928.2-1054s1c1
Sequence:CCGGCGCTTCAACGTGGATGAAGTACTCGAGTACTTCATCCACGTTGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030928.2-1438s1c1
Sequence:CCGGCGGAGCGTCTTTGTGTCCGAACTCGAGTTCGGACACAAAGACGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030928
CDT1 MISSION shRNA shRNA Plasmid DNA
chromatin licensing and DNA replication factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030928.3-966s21c1
Sequence:CCGGGCATGTCAAGGAGCACCACAACTCGAGTTGTGGTGCTCCTTGACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030928.2-754s1c2
Sequence:CCGGCGCAATGTTGGCCAGATCAAACTCGAGTTTGATCTGGCCAACATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030928.3-1891s21c1
Sequence:CCGGACCTGGTGGATTCACATTAAACTCGAGTTTAATGTGAATCCACCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030928.3-2064s21c1
Sequence:CCGGTAATCTTGGAACCTCTGAATACTCGAGTATTCAGAGGTTCCAAGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030928.3-1609s21c1
Sequence:CCGGACCTACGTCAAGCTGGACAAGCTCGAGCTTGTCCAGCTTGACGTAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030928.3-1765s21c1
Sequence:CCGGTTATGAACATGATACACTTTGCTCGAGCAAAGTGTATCATGTTCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073298    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_030928.2-2636s1c1
Sequence:CCGGGACCTCCTAAACTCTAATAAACTCGAGTTTATTAGAGTTTAGGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030928.2-1054s1c1
Sequence:CCGGCGCTTCAACGTGGATGAAGTACTCGAGTACTTCATCCACGTTGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030928.2-1438s1c1
Sequence:CCGGCGGAGCGTCTTTGTGTCCGAACTCGAGTTCGGACACAAAGACGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030928
CDT1 MISSION shRNA Lentiviral Transduction Particles
chromatin licensing and DNA replication factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030928.3-966s21c1
Sequence:CCGGGCATGTCAAGGAGCACCACAACTCGAGTTGTGGTGCTCCTTGACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030928.2-754s1c2
Sequence:CCGGCGCAATGTTGGCCAGATCAAACTCGAGTTTGATCTGGCCAACATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030928.3-1891s21c1
Sequence:CCGGACCTGGTGGATTCACATTAAACTCGAGTTTAATGTGAATCCACCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030928.3-2064s21c1
Sequence:CCGGTAATCTTGGAACCTCTGAATACTCGAGTATTCAGAGGTTCCAAGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030928.3-1609s21c1
Sequence:CCGGACCTACGTCAAGCTGGACAAGCTCGAGCTTGTCCAGCTTGACGTAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030928.3-1765s21c1
Sequence:CCGGTTATGAACATGATACACTTTGCTCGAGCAAAGTGTATCATGTTCATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073298    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_030928.2-2636s1c1
Sequence:CCGGGACCTCCTAAACTCTAATAAACTCGAGTTTATTAGAGTTTAGGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030928.2-1054s1c1
Sequence:CCGGCGCTTCAACGTGGATGAAGTACTCGAGTACTTCATCCACGTTGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030928.2-1438s1c1
Sequence:CCGGCGGAGCGTCTTTGTGTCCGAACTCGAGTTCGGACACAAAGACGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026014
VALIDATED
CDT1 MISSION shRNA Bacterial Glycerol Stock
chromatin licensing and DNA replication factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026014.3-364s21c1
Sequence:CCGGCCGTCAAGCGAACAAAGAGTACTCGAGTACTCTTTGTTCGCTTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026014.3-860s21c1
Sequence:CCGGCAGCATCAAGAGATCTGATTACTCGAGTAATCAGATCTCTTGATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026014.3-1337s21c1
Sequence:CCGGAGCACTGCTAGAGCGGATAAGCTCGAGCTTATCCGCTCTAGCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026014.3-1750s21c1
Sequence:CCGGACGACGCACTTACGCCTTTAACTCGAGTTAAAGGCGTAAGTGCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026014.3-714s21c1
Sequence:CCGGGAGACTGTGACCTTTGCCAAACTCGAGTTTGGCAAAGGTCACAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-1805s1c1
Sequence:CCGGGATCTCATAAAGTGCTGGCATCTCGAGATGCCAGCACTTTATGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-860s1c1
Sequence:CCGGCAGCATCAAGAGATCTGATTACTCGAGTAATCAGATCTCTTGATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-714s1c1
Sequence:CCGGGAGACTGTGACCTTTGCCAAACTCGAGTTTGGCAAAGGTCACAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-364s1c1
Sequence:CCGGCCGTCAAGCGAACAAAGAGTACTCGAGTACTCTTTGTTCGCTTGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026014
VALIDATED
CDT1 MISSION shRNA shRNA Plasmid DNA
chromatin licensing and DNA replication factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026014.3-364s21c1
Sequence:CCGGCCGTCAAGCGAACAAAGAGTACTCGAGTACTCTTTGTTCGCTTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026014.3-860s21c1
Sequence:CCGGCAGCATCAAGAGATCTGATTACTCGAGTAATCAGATCTCTTGATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026014.3-1337s21c1
Sequence:CCGGAGCACTGCTAGAGCGGATAAGCTCGAGCTTATCCGCTCTAGCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026014.3-1750s21c1
Sequence:CCGGACGACGCACTTACGCCTTTAACTCGAGTTAAAGGCGTAAGTGCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026014.3-714s21c1
Sequence:CCGGGAGACTGTGACCTTTGCCAAACTCGAGTTTGGCAAAGGTCACAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-1805s1c1
Sequence:CCGGGATCTCATAAAGTGCTGGCATCTCGAGATGCCAGCACTTTATGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-860s1c1
Sequence:CCGGCAGCATCAAGAGATCTGATTACTCGAGTAATCAGATCTCTTGATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-714s1c1
Sequence:CCGGGAGACTGTGACCTTTGCCAAACTCGAGTTTGGCAAAGGTCACAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-364s1c1
Sequence:CCGGCCGTCAAGCGAACAAAGAGTACTCGAGTACTCTTTGTTCGCTTGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026014
VALIDATED
CDT1 MISSION shRNA Lentiviral Transduction Particles
chromatin licensing and DNA replication factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026014.3-364s21c1
Sequence:CCGGCCGTCAAGCGAACAAAGAGTACTCGAGTACTCTTTGTTCGCTTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026014.3-860s21c1
Sequence:CCGGCAGCATCAAGAGATCTGATTACTCGAGTAATCAGATCTCTTGATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026014.3-1337s21c1
Sequence:CCGGAGCACTGCTAGAGCGGATAAGCTCGAGCTTATCCGCTCTAGCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026014.3-1750s21c1
Sequence:CCGGACGACGCACTTACGCCTTTAACTCGAGTTAAAGGCGTAAGTGCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026014.3-714s21c1
Sequence:CCGGGAGACTGTGACCTTTGCCAAACTCGAGTTTGGCAAAGGTCACAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-1805s1c1
Sequence:CCGGGATCTCATAAAGTGCTGGCATCTCGAGATGCCAGCACTTTATGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-860s1c1
Sequence:CCGGCAGCATCAAGAGATCTGATTACTCGAGTAATCAGATCTCTTGATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-714s1c1
Sequence:CCGGGAGACTGTGACCTTTGCCAAACTCGAGTTTGGCAAAGGTCACAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026014.3-364s1c1
Sequence:CCGGCCGTCAAGCGAACAAAGAGTACTCGAGTACTCTTTGTTCGCTTGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)