EMAIL THIS PAGE TO A FRIEND

CDV3

CDV3 homolog (mouse)

219 Gene Product Result for
Synonyms: H41
UniProtKB ID: Q9UKY7, B3KUC2, Q96IP9
Gene ID:
Mouse(321022) carnitine deficiency-associated gene expressed in ventricle 3
Rat(315970) carnitine deficiency-associated gene expressed in ventricle 3 homolog (mouse)
Zebrafish(334102) carnitine deficiency-associated gene expressed in ventricle 3
cow(504871) CDV3 homolog (mouse)
domestic cat(101089890) CDV3 homolog (mouse)
dog(100685602) CDV3 homolog (mouse)
chicken(420693) CDV3 homolog (mouse)
sheep(101115093) CDV3 homolog (mouse)
naked mole-rat(101715117) CDV3 homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017548 Rosetta Predictions human pricing
NM_001014097 Rosetta Predictions rat pricing
NM_175565 Rosetta Predictions mouse pricing
NM_175833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156731 predicted 1252
2 SASI_Hs01_00156732 predicted 1390
3 SASI_Hs01_00156733 predicted 1035
4 SASI_Hs01_00156734 predicted 1399
5 SASI_Hs01_00156735 predicted 1290
6 SASI_Hs01_00156736 predicted 1418
7 SASI_Hs01_00156737 predicted 1446
8 SASI_Hs02_00350181 predicted 920
9 SASI_Hs01_00156738 predicted 1456
10 SASI_Hs01_00156740 predicted 1472
11 SASI_Hs01_00156739 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084098 predicted 773
2 SASI_Rn01_00084100 predicted 760
3 SASI_Rn01_00084102 predicted 749
4 SASI_Rn01_00084103 predicted 760
5 SASI_Rn01_00084105 predicted 747
6 SASI_Rn02_00201532 predicted 835
7 SASI_Rn01_00084106 predicted 750
8 SASI_Rn01_00084107 predicted 821
9 SASI_Rn02_00201533 predicted 818
10 SASI_Rn02_00201534 predicted 759
11 SASI_Rn01_00084099 predicted 920
12 SASI_Rn01_00084101 predicted 963
13 SASI_Rn01_00084104 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173795 predicted 1125
2 SASI_Mm01_00173796 predicted 1289
3 SASI_Mm01_00173797 predicted 1155
4 SASI_Mm01_00173798 predicted 1487
5 SASI_Mm01_00173800 predicted 1139
6 SASI_Mm01_00173801 predicted 1364
7 SASI_Mm01_00173802 predicted 1538
8 SASI_Mm01_00173803 predicted 1535
9 SASI_Mm01_00173804 predicted 1164
10 SASI_Mm02_00346550 predicted 1114
11 SASI_Mm01_00173799 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190206 predicted 736
2 SASI_Mm01_00190208 predicted 754
3 SASI_Mm01_00190202 predicted 1527
4 SASI_Mm01_00190203 predicted 1591
5 SASI_Mm01_00190204 predicted 1483
6 SASI_Mm01_00190205 predicted 1604
7 SASI_Mm01_00190207 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175565
VALIDATED
CDV3 MISSION shRNA Bacterial Glycerol Stock
CDV3 homolog (mouse)
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-532s1c1
Sequence:CCGGGCGGATTAAGAGTTCAGGCAACTCGAGTTGCCTGAACTCTTAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-2500s1c1
Sequence:CCGGCCTTGCTTTGACTCAGAGTAACTCGAGTTACTCTGAGTCAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-2305s1c1
Sequence:CCGGGCTGTCAGAAATGATGTGTTTCTCGAGAAACACATCATTTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-576s1c1
Sequence:CCGGGATGATAATGAGAAGAGAGAACTCGAGTTCTCTCTTCTCATTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-495s1c1
Sequence:CCGGGAGTGGAAAGAATTTGAGCAACTCGAGTTGCTCAAATTCTTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-597s1c1
Sequence:CCGGGATCCAGGAGATAATTGGGAACTCGAGTTCCCAATTATCTCCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-519s1c1
Sequence:CCGGGAGGTTGATTACAGCGGATTACTCGAGTAATCCGCTGTAATCAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-1881s1c1
Sequence:CCGGCGACTGATCTTGATGTGTGTTCTCGAGAACACACATCAAGATCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-693s1c1
Sequence:CCGGGCTCCAGTAACAGTTACAGAACTCGAGTTCTGTAACTGTTACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-600s1c1
Sequence:CCGGCCAGGAGATAATTGGGAAGAACTCGAGTTCTTCCCAATTATCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175565.3-839s21c1
Sequence:CCGGGATCCAGGAGATAATTGGGAACTCGAGTTCCCAATTATCTCCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175565.3-2746s21c1
Sequence:CCGGCCTTGCTTTGACTCAGAGTAACTCGAGTTACTCTGAGTCAAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175565.3-2128s21c1
Sequence:CCGGCGACTGATCTTGATGTGTGTTCTCGAGAACACACATCAAGATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175565.3-761s21c1
Sequence:CCGGGAGGTTGATTACAGCGGATTACTCGAGTAATCCGCTGTAATCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175565.3-2553s21c1
Sequence:CCGGGCTGTCAGAAATGATGTGTTTCTCGAGAAACACATCATTTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175565
VALIDATED
CDV3 MISSION shRNA shRNA Plasmid DNA
CDV3 homolog (mouse)
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-532s1c1
Sequence:CCGGGCGGATTAAGAGTTCAGGCAACTCGAGTTGCCTGAACTCTTAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-2500s1c1
Sequence:CCGGCCTTGCTTTGACTCAGAGTAACTCGAGTTACTCTGAGTCAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-2305s1c1
Sequence:CCGGGCTGTCAGAAATGATGTGTTTCTCGAGAAACACATCATTTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-576s1c1
Sequence:CCGGGATGATAATGAGAAGAGAGAACTCGAGTTCTCTCTTCTCATTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-495s1c1
Sequence:CCGGGAGTGGAAAGAATTTGAGCAACTCGAGTTGCTCAAATTCTTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-597s1c1
Sequence:CCGGGATCCAGGAGATAATTGGGAACTCGAGTTCCCAATTATCTCCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-519s1c1
Sequence:CCGGGAGGTTGATTACAGCGGATTACTCGAGTAATCCGCTGTAATCAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-1881s1c1
Sequence:CCGGCGACTGATCTTGATGTGTGTTCTCGAGAACACACATCAAGATCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-693s1c1
Sequence:CCGGGCTCCAGTAACAGTTACAGAACTCGAGTTCTGTAACTGTTACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-600s1c1
Sequence:CCGGCCAGGAGATAATTGGGAAGAACTCGAGTTCTTCCCAATTATCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175565.3-839s21c1
Sequence:CCGGGATCCAGGAGATAATTGGGAACTCGAGTTCCCAATTATCTCCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175565.3-2746s21c1
Sequence:CCGGCCTTGCTTTGACTCAGAGTAACTCGAGTTACTCTGAGTCAAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175565.3-2128s21c1
Sequence:CCGGCGACTGATCTTGATGTGTGTTCTCGAGAACACACATCAAGATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175565.3-761s21c1
Sequence:CCGGGAGGTTGATTACAGCGGATTACTCGAGTAATCCGCTGTAATCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175565.3-2553s21c1
Sequence:CCGGGCTGTCAGAAATGATGTGTTTCTCGAGAAACACATCATTTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175565
VALIDATED
CDV3 MISSION shRNA Lentiviral Transduction Particles
CDV3 homolog (mouse)
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-532s1c1
Sequence:CCGGGCGGATTAAGAGTTCAGGCAACTCGAGTTGCCTGAACTCTTAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-2500s1c1
Sequence:CCGGCCTTGCTTTGACTCAGAGTAACTCGAGTTACTCTGAGTCAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-2305s1c1
Sequence:CCGGGCTGTCAGAAATGATGTGTTTCTCGAGAAACACATCATTTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-576s1c1
Sequence:CCGGGATGATAATGAGAAGAGAGAACTCGAGTTCTCTCTTCTCATTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-495s1c1
Sequence:CCGGGAGTGGAAAGAATTTGAGCAACTCGAGTTGCTCAAATTCTTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-597s1c1
Sequence:CCGGGATCCAGGAGATAATTGGGAACTCGAGTTCCCAATTATCTCCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-519s1c1
Sequence:CCGGGAGGTTGATTACAGCGGATTACTCGAGTAATCCGCTGTAATCAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175565.2-1881s1c1
Sequence:CCGGCGACTGATCTTGATGTGTGTTCTCGAGAACACACATCAAGATCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-693s1c1
Sequence:CCGGGCTCCAGTAACAGTTACAGAACTCGAGTTCTGTAACTGTTACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175565.2-600s1c1
Sequence:CCGGCCAGGAGATAATTGGGAAGAACTCGAGTTCTTCCCAATTATCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175565.3-839s21c1
Sequence:CCGGGATCCAGGAGATAATTGGGAACTCGAGTTCCCAATTATCTCCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175565.3-2746s21c1
Sequence:CCGGCCTTGCTTTGACTCAGAGTAACTCGAGTTACTCTGAGTCAAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175565.3-2128s21c1
Sequence:CCGGCGACTGATCTTGATGTGTGTTCTCGAGAACACACATCAAGATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175565.3-761s21c1
Sequence:CCGGGAGGTTGATTACAGCGGATTACTCGAGTAATCCGCTGTAATCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175565.3-2553s21c1
Sequence:CCGGGCTGTCAGAAATGATGTGTTTCTCGAGAAACACATCATTTCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017548
VALIDATED
CDV3 MISSION shRNA Bacterial Glycerol Stock
CDV3 homolog (mouse)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-559s1c1
Sequence:CCGGCGAAGGACGAAGATGAATGGACTCGAGTCCATTCATCTTCGTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-681s1c1
Sequence:CCGGCCAGGTGATAACTGGGAAGAACTCGAGTTCTTCCCAGTTATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017548.2-673s1c1
Sequence:CCGGGACAAGATCCAGGTGATAACTCTCGAGAGTTATCACCTGGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-845s1c1
Sequence:CCGGCAGGTTAACCACAACAAGGAACTCGAGTTCCTTGTTGTGGTTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-929s1c1
Sequence:CCGGCAAGCATGTAGAAAGCCGGAACTCGAGTTCCGGCTTTCTACATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017548.2-771s1c1
Sequence:CCGGCCTCCTGCTCCAGTAATTGTTCTCGAGAACAATTACTGGAGCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-903s21c1
Sequence:CCGGCCTCCTGCTCCAGTAATTGTTCTCGAGAACAATTACTGGAGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-1213s21c1
Sequence:CCGGGCCACTCACAATACAATTAAGCTCGAGCTTAATTGTATTGTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-751s21c1
Sequence:CCGGGGGTTCAGGCAATGCAAATAACTCGAGTTATTTGCATTGCCTGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-1168s21c1
Sequence:CCGGTTCAGCTAGACAACCAATATGCTCGAGCATATTGGTTGTCTAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-1328s21c1
Sequence:CCGGCCGATGCAGACCACTCGATTTCTCGAGAAATCGAGTGGTCTGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017548
VALIDATED
CDV3 MISSION shRNA shRNA Plasmid DNA
CDV3 homolog (mouse)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-559s1c1
Sequence:CCGGCGAAGGACGAAGATGAATGGACTCGAGTCCATTCATCTTCGTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-681s1c1
Sequence:CCGGCCAGGTGATAACTGGGAAGAACTCGAGTTCTTCCCAGTTATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017548.2-673s1c1
Sequence:CCGGGACAAGATCCAGGTGATAACTCTCGAGAGTTATCACCTGGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-845s1c1
Sequence:CCGGCAGGTTAACCACAACAAGGAACTCGAGTTCCTTGTTGTGGTTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-929s1c1
Sequence:CCGGCAAGCATGTAGAAAGCCGGAACTCGAGTTCCGGCTTTCTACATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017548.2-771s1c1
Sequence:CCGGCCTCCTGCTCCAGTAATTGTTCTCGAGAACAATTACTGGAGCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-903s21c1
Sequence:CCGGCCTCCTGCTCCAGTAATTGTTCTCGAGAACAATTACTGGAGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-1213s21c1
Sequence:CCGGGCCACTCACAATACAATTAAGCTCGAGCTTAATTGTATTGTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-751s21c1
Sequence:CCGGGGGTTCAGGCAATGCAAATAACTCGAGTTATTTGCATTGCCTGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-1168s21c1
Sequence:CCGGTTCAGCTAGACAACCAATATGCTCGAGCATATTGGTTGTCTAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-1328s21c1
Sequence:CCGGCCGATGCAGACCACTCGATTTCTCGAGAAATCGAGTGGTCTGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017548
VALIDATED
CDV3 MISSION shRNA Lentiviral Transduction Particles
CDV3 homolog (mouse)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-559s1c1
Sequence:CCGGCGAAGGACGAAGATGAATGGACTCGAGTCCATTCATCTTCGTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-681s1c1
Sequence:CCGGCCAGGTGATAACTGGGAAGAACTCGAGTTCTTCCCAGTTATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017548.2-673s1c1
Sequence:CCGGGACAAGATCCAGGTGATAACTCTCGAGAGTTATCACCTGGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-845s1c1
Sequence:CCGGCAGGTTAACCACAACAAGGAACTCGAGTTCCTTGTTGTGGTTAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017548.2-929s1c1
Sequence:CCGGCAAGCATGTAGAAAGCCGGAACTCGAGTTCCGGCTTTCTACATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017548.2-771s1c1
Sequence:CCGGCCTCCTGCTCCAGTAATTGTTCTCGAGAACAATTACTGGAGCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-903s21c1
Sequence:CCGGCCTCCTGCTCCAGTAATTGTTCTCGAGAACAATTACTGGAGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-1213s21c1
Sequence:CCGGGCCACTCACAATACAATTAAGCTCGAGCTTAATTGTATTGTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-751s21c1
Sequence:CCGGGGGTTCAGGCAATGCAAATAACTCGAGTTATTTGCATTGCCTGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-1168s21c1
Sequence:CCGGTTCAGCTAGACAACCAATATGCTCGAGCATATTGGTTGTCTAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_017548.4-1328s21c1
Sequence:CCGGCCGATGCAGACCACTCGATTTCTCGAGAAATCGAGTGGTCTGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks