EMAIL THIS PAGE TO A FRIEND

CDX1

caudal type homeobox 1

56 Gene Product Result for
UniProtKB ID: P47902, Q4VAU4, Q9NYK8
Gene ID:
Human(1044) Summary: This gene is a member of the caudal-related homeobox transcription factor gene family. The encoded DNA-binding protein regulates intestine-specific gene expression and enterocyte differentiation. It has been shown to induce expression of the intestinal alkaline phosphatase gene, and inhibit beta-catenin/T-cell factor transcriptional activity. [provided by RefSeq, Jul 2008]
Mouse(12590) caudal type homeobox 1
Rat(364883) caudal type homeo box 1
chicken(395397) caudal type homeobox 1
domestic cat(101086702) caudal type homeobox 1
cow(511830) caudal type homeobox 1
dog(612256) caudal type homeobox 1
naked mole-rat(101721517) caudal type homeobox 1
domestic guinea pig(100734939) caudal type homeobox 1
sheep(101123037) caudal type homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001804 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001804 Rosetta Predictions human pricing
XM_001062129 Rosetta Predictions rat pricing
XM_344691 Rosetta Predictions rat pricing
NM_009880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240449 predicted 1053
2 SASI_Hs01_00240446 predicted 1315
3 SASI_Hs01_00240447 predicted 663
4 SASI_Hs01_00240448 predicted 1044
5 SASI_Hs01_00240450 predicted 707
6 SASI_Hs01_00240451 predicted 704
7 SASI_Hs01_00240452 predicted 1248
8 SASI_Hs01_00240453 predicted 1130
9 SASI_Hs01_00240454 predicted 724
10 SASI_Hs01_00240455 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302467 predicted 201
2 SASI_Rn02_00302468 predicted 209
3 SASI_Rn02_00302469 predicted 11
4 SASI_Rn02_00302470 predicted 30
5 SASI_Rn02_00302471 predicted 382
6 SASI_Rn02_00302472 predicted 272
7 SASI_Rn02_00302473 predicted 50
8 SASI_Rn02_00302474 predicted 369
9 SASI_Rn02_00302475 predicted 249
10 SASI_Rn02_00302476 predicted 8
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397441 predicted 245
2 SASI_Rn02_00397442 predicted 316
3 SASI_Rn02_00397443 predicted 301
4 SASI_Rn02_00397444 predicted 287
5 SASI_Rn02_00397445 predicted 317
6 SASI_Rn02_00397446 predicted 251
7 SASI_Rn02_00397447 predicted 319
8 SASI_Rn02_00397448 predicted 292
9 SASI_Rn02_00397449 predicted 241
10 SASI_Rn02_00397450 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055423 predicted 1154
2 SASI_Mm01_00055424 predicted 593
3 SASI_Mm01_00055425 predicted 1180
4 SASI_Mm01_00055426 predicted 1309
5 SASI_Mm01_00055427 predicted 1292
6 SASI_Mm01_00055428 predicted 851
7 SASI_Mm01_00055429 predicted 1284
8 SASI_Mm01_00055430 predicted 907
9 SASI_Mm01_00055431 predicted 514
10 SASI_Mm01_00055432 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009880
CDX1 MISSION shRNA Bacterial Glycerol Stock
caudal type homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009880.3-810s21c1
Sequence:CCGGGAAGTCTATGCCCTACTAATGCTCGAGCATTAGTAGGGCATAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009880.3-1133s21c1
Sequence:CCGGGCCCAATGAGAAGTCTCAATCCTCGAGGATTGAGACTTCTCATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009880.3-907s21c1
Sequence:CCGGAGGGATCTAGGGACTTGAATGCTCGAGCATTCAAGTCCCTAGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009880.2-1287s1c1
Sequence:CCGGCGGCATTGAAAGAAGGTGGTACTCGAGTACCACCTTCTTTCAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-860s1c1
Sequence:CCGGCCCGTCAAGGAGGAGTTTCTACTCGAGTAGAAACTCCTCCTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-706s1c1
Sequence:CCGGGCGCAAAGTAAACAAGAAGAACTCGAGTTCTTCTTGTTTACTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-520s1c1
Sequence:CCGGCAGCGGTAAGACCCGAACCAACTCGAGTTGGTTCGGGTCTTACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-595s1c1
Sequence:CCGGGTTTCACTACAGCCGGTACATCTCGAGATGTACCGGCTGTAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009880
CDX1 MISSION shRNA shRNA Plasmid DNA
caudal type homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009880.3-810s21c1
Sequence:CCGGGAAGTCTATGCCCTACTAATGCTCGAGCATTAGTAGGGCATAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009880.3-1133s21c1
Sequence:CCGGGCCCAATGAGAAGTCTCAATCCTCGAGGATTGAGACTTCTCATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009880.3-907s21c1
Sequence:CCGGAGGGATCTAGGGACTTGAATGCTCGAGCATTCAAGTCCCTAGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009880.2-1287s1c1
Sequence:CCGGCGGCATTGAAAGAAGGTGGTACTCGAGTACCACCTTCTTTCAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-860s1c1
Sequence:CCGGCCCGTCAAGGAGGAGTTTCTACTCGAGTAGAAACTCCTCCTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-706s1c1
Sequence:CCGGGCGCAAAGTAAACAAGAAGAACTCGAGTTCTTCTTGTTTACTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-520s1c1
Sequence:CCGGCAGCGGTAAGACCCGAACCAACTCGAGTTGGTTCGGGTCTTACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-595s1c1
Sequence:CCGGGTTTCACTACAGCCGGTACATCTCGAGATGTACCGGCTGTAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009880
CDX1 MISSION shRNA Lentiviral Transduction Particles
caudal type homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009880.3-810s21c1
Sequence:CCGGGAAGTCTATGCCCTACTAATGCTCGAGCATTAGTAGGGCATAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009880.3-1133s21c1
Sequence:CCGGGCCCAATGAGAAGTCTCAATCCTCGAGGATTGAGACTTCTCATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009880.3-907s21c1
Sequence:CCGGAGGGATCTAGGGACTTGAATGCTCGAGCATTCAAGTCCCTAGATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009880.2-1287s1c1
Sequence:CCGGCGGCATTGAAAGAAGGTGGTACTCGAGTACCACCTTCTTTCAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-860s1c1
Sequence:CCGGCCCGTCAAGGAGGAGTTTCTACTCGAGTAGAAACTCCTCCTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-706s1c1
Sequence:CCGGGCGCAAAGTAAACAAGAAGAACTCGAGTTCTTCTTGTTTACTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-520s1c1
Sequence:CCGGCAGCGGTAAGACCCGAACCAACTCGAGTTGGTTCGGGTCTTACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009880.2-595s1c1
Sequence:CCGGGTTTCACTACAGCCGGTACATCTCGAGATGTACCGGCTGTAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001804
CDX1 MISSION shRNA Bacterial Glycerol Stock
caudal type homeobox 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001804.2-560s21c1
Sequence:CCGGACAAGTACCGCGTGGTCTACACTCGAGTGTAGACCACGCGGTACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-709s1c1
Sequence:CCGGCGCAAAGTGAACAAGAAGAAACTCGAGTTTCTTCTTGTTCACTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-597s1c1
Sequence:CCGGGTTTCATTACAGCCGTTACATCTCGAGATGTAACGGCTGTAATGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-522s1c1
Sequence:CCGGCAGCGGTAAGACTCGGACCAACTCGAGTTGGTCCGAGTCTTACCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001804.1-1236s1c1
Sequence:CCGGACCACACTGATCCTGGAGAAACTCGAGTTTCTCCAGGATCAGTGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-841s1c1
Sequence:CCGGTCCTCTCCAATGCCTGTGAAACTCGAGTTTCACAGGCATTGGAGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001804
CDX1 MISSION shRNA shRNA Plasmid DNA
caudal type homeobox 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001804.2-560s21c1
Sequence:CCGGACAAGTACCGCGTGGTCTACACTCGAGTGTAGACCACGCGGTACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-709s1c1
Sequence:CCGGCGCAAAGTGAACAAGAAGAAACTCGAGTTTCTTCTTGTTCACTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-597s1c1
Sequence:CCGGGTTTCATTACAGCCGTTACATCTCGAGATGTAACGGCTGTAATGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-522s1c1
Sequence:CCGGCAGCGGTAAGACTCGGACCAACTCGAGTTGGTCCGAGTCTTACCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001804.1-1236s1c1
Sequence:CCGGACCACACTGATCCTGGAGAAACTCGAGTTTCTCCAGGATCAGTGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-841s1c1
Sequence:CCGGTCCTCTCCAATGCCTGTGAAACTCGAGTTTCACAGGCATTGGAGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001804
CDX1 MISSION shRNA Lentiviral Transduction Particles
caudal type homeobox 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001804.2-560s21c1
Sequence:CCGGACAAGTACCGCGTGGTCTACACTCGAGTGTAGACCACGCGGTACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-709s1c1
Sequence:CCGGCGCAAAGTGAACAAGAAGAAACTCGAGTTTCTTCTTGTTCACTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-597s1c1
Sequence:CCGGGTTTCATTACAGCCGTTACATCTCGAGATGTAACGGCTGTAATGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-522s1c1
Sequence:CCGGCAGCGGTAAGACTCGGACCAACTCGAGTTGGTCCGAGTCTTACCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001804.1-1236s1c1
Sequence:CCGGACCACACTGATCCTGGAGAAACTCGAGTTTCTCCAGGATCAGTGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001804.1-841s1c1
Sequence:CCGGTCCTCTCCAATGCCTGTGAAACTCGAGTTTCACAGGCATTGGAGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks