EMAIL THIS PAGE TO A FRIEND

CDX2

caudal type homeobox 2

Synonyms: CDX-3 CDX3
UniProtKB ID: Q99626, O00503, Q5VTU7, Q969L8, Q9UD92
Gene ID:
Human(1045) Summary: This gene is a member of the caudal-related homeobox transcription factor gene family. The encoded protein is a major regulator of intestine-specific genes involved in cell growth an differentiation. This protein also plays a role in early embryonic development of the intestinal tract. Aberrant expression of this gene is associated with intestinal inflammation and tumorigenesis. [provided by RefSeq, Jan 2012]
Mouse(12591) caudal type homeobox 2
Rat(66019) caudal type homeo box 2
chicken(374205) caudal type homeobox 2
cow(618679) caudal type homeobox 2
domestic cat(101099011) caudal type homeobox 2
dog(486028) caudal type homeobox 2
sheep(101112831) caudal type homeobox 2
domestic guinea pig(100720187) caudal type homeobox 2
naked mole-rat(101714659) caudal type homeobox 2
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301787 Anti-CDX2 affinity isolated antibody human
immunohistochemistry, western blot pricing
C6872 Anti-CDX2 (171-185) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C6747 Anti-CDX2 (71-83) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500223 Anti-CDX2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, mouse, rat
ELISA, western blot pricing
AV31476 Anti-CDX2 antibody produced in rabbit affinity isolated antibody human, canine, mouse, rabbit, horse, bovine, rat, guinea pig
western blot pricing
SAB3500187 Anti-CDX2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA045669 Anti-CDX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA049580 Anti-CDX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB5500078 Anti-CDX2 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP54, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
WH0001045M1 Monoclonal Anti-CDX2 antibody produced in mouse clone 1C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001265 Rosetta Predictions human pricing
NM_023963 Rosetta Predictions rat pricing
NM_007673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331459 predicted 1602
2 SASI_Hs02_00331460 predicted 1435
3 SASI_Hs01_00166861 predicted 1154
4 SASI_Hs02_00331461 predicted 1287
5 SASI_Hs01_00166858 predicted 1480
6 SASI_Hs01_00166860 predicted 1489
7 SASI_Hs01_00166864 predicted 1222
8 SASI_Hs01_00166859 predicted 1601
9 SASI_Hs02_00331462 predicted 1124
10 SASI_Hs01_00166866 predicted 837
11 SASI_Hs01_00166862 predicted 1372
12 SASI_Hs01_00166863 predicted 1291
13 SASI_Hs01_00166865 predicted 1125
14 SASI_Hs01_00166867 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082267 predicted 438
2 SASI_Rn01_00082268 predicted 220
3 SASI_Rn01_00082271 predicted 448
4 SASI_Rn02_00263772 predicted 584
5 SASI_Rn01_00082272 predicted 216
6 SASI_Rn01_00082273 predicted 368
7 SASI_Rn01_00082274 predicted 264
8 SASI_Rn01_00082275 predicted 211
9 SASI_Rn01_00082276 predicted 500
10 SASI_Rn02_00263773 predicted 173
11 SASI_Rn01_00082269 predicted 595
12 SASI_Rn01_00082270 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169249 predicted 327
2 SASI_Mm01_00169250 predicted 294
3 SASI_Mm01_00169251 predicted 589
4 SASI_Mm01_00169252 predicted 408
5 SASI_Mm01_00169253 predicted 744
6 SASI_Mm01_00169254 predicted 378
7 SASI_Mm01_00169255 predicted 525
8 SASI_Mm01_00169256 predicted 876
9 SASI_Mm01_00169257 predicted 1456
10 SASI_Mm01_00169258 predicted 1491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001265
CDX2 MISSION shRNA Bacterial Glycerol Stock
caudal type homeobox 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-732s1c1
Sequence:CCGGAGACAAATATCGAGTGGTGTACTCGAGTACACCACTCGATATTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-882s1c1
Sequence:CCGGCCGCAGAGCAAAGGAGAGGAACTCGAGTTCCTCTCCTTTGCTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001265.2-1822s1c1
Sequence:CCGGGCTGAATGTATGTCAGTGCTACTCGAGTAGCACTGACATACATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-393s1c1
Sequence:CCGGCCGGGAGGACTGGAATGGCTACTCGAGTAGCCATTCCAGTCCTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-1013s1c1
Sequence:CCGGAGCCCTTGAGTCCGGTGTCTTCTCGAGAAGACACCGGACTCAAGGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001265.3-735s21c1
Sequence:CCGGCAAATATCGAGTGGTGTACACCTCGAGGTGTACACCACTCGATATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001265.3-1210s21c1
Sequence:CCGGACCCACAGCCATAGACCTACACTCGAGTGTAGGTCTATGGCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001265.3-786s21c1
Sequence:CCGGGTTTCACTACAGTCGCTACATCTCGAGATGTAGCGACTGTAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001265.3-203s21c1
Sequence:CCGGACGTGAGCATGTACCCTAGCTCTCGAGAGCTAGGGTACATGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001265.3-1253s21c1
Sequence:CCGGTGGGAGCCAGGAGTAAGACAACTCGAGTTGTCTTACTCCTGGCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001265
CDX2 MISSION shRNA shRNA Plasmid DNA
caudal type homeobox 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-732s1c1
Sequence:CCGGAGACAAATATCGAGTGGTGTACTCGAGTACACCACTCGATATTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-882s1c1
Sequence:CCGGCCGCAGAGCAAAGGAGAGGAACTCGAGTTCCTCTCCTTTGCTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001265.2-1822s1c1
Sequence:CCGGGCTGAATGTATGTCAGTGCTACTCGAGTAGCACTGACATACATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-393s1c1
Sequence:CCGGCCGGGAGGACTGGAATGGCTACTCGAGTAGCCATTCCAGTCCTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-1013s1c1
Sequence:CCGGAGCCCTTGAGTCCGGTGTCTTCTCGAGAAGACACCGGACTCAAGGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001265.3-735s21c1
Sequence:CCGGCAAATATCGAGTGGTGTACACCTCGAGGTGTACACCACTCGATATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001265.3-1210s21c1
Sequence:CCGGACCCACAGCCATAGACCTACACTCGAGTGTAGGTCTATGGCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001265.3-786s21c1
Sequence:CCGGGTTTCACTACAGTCGCTACATCTCGAGATGTAGCGACTGTAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001265.3-203s21c1
Sequence:CCGGACGTGAGCATGTACCCTAGCTCTCGAGAGCTAGGGTACATGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001265.3-1253s21c1
Sequence:CCGGTGGGAGCCAGGAGTAAGACAACTCGAGTTGTCTTACTCCTGGCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001265
CDX2 MISSION shRNA Lentiviral Transduction Particles
caudal type homeobox 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-732s1c1
Sequence:CCGGAGACAAATATCGAGTGGTGTACTCGAGTACACCACTCGATATTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-882s1c1
Sequence:CCGGCCGCAGAGCAAAGGAGAGGAACTCGAGTTCCTCTCCTTTGCTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001265.2-1822s1c1
Sequence:CCGGGCTGAATGTATGTCAGTGCTACTCGAGTAGCACTGACATACATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-393s1c1
Sequence:CCGGCCGGGAGGACTGGAATGGCTACTCGAGTAGCCATTCCAGTCCTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001265.2-1013s1c1
Sequence:CCGGAGCCCTTGAGTCCGGTGTCTTCTCGAGAAGACACCGGACTCAAGGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001265.3-735s21c1
Sequence:CCGGCAAATATCGAGTGGTGTACACCTCGAGGTGTACACCACTCGATATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001265.3-1210s21c1
Sequence:CCGGACCCACAGCCATAGACCTACACTCGAGTGTAGGTCTATGGCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001265.3-786s21c1
Sequence:CCGGGTTTCACTACAGTCGCTACATCTCGAGATGTAGCGACTGTAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001265.3-203s21c1
Sequence:CCGGACGTGAGCATGTACCCTAGCTCTCGAGAGCTAGGGTACATGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001265.3-1253s21c1
Sequence:CCGGTGGGAGCCAGGAGTAAGACAACTCGAGTTGTCTTACTCCTGGCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007673
CDX2 MISSION shRNA Bacterial Glycerol Stock
caudal type homeobox 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-877s1c1
Sequence:CCGGGTTTCACTTTAGTCGATACATCTCGAGATGTATCGACTAAAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-833s1c1
Sequence:CCGGCGGGTGGTGTACACAGACCATCTCGAGATGGTCTGTGTACACCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-751s1c1
Sequence:CCGGGCGAAACCTGTGCGAGTGGATCTCGAGATCCACTCGCACAGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-620s1c1
Sequence:CCGGCCGCATCATCACCCGCACCATCTCGAGATGGTGCGGGTGATGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-937s1c1
Sequence:CCGGGCTCTCCGAGAGGCAGGTTAACTCGAGTTAACCTGCCTCTCGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007673.3-789s21c1
Sequence:CCGGGTCCCTAGGAAGCCAAGTGAACTCGAGTTCACTTGGCTTCCTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007673.3-1260s21c1
Sequence:CCGGAGTATGGACGCTGCGAGAATCCTCGAGGATTCTCGCAGCGTCCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007673
CDX2 MISSION shRNA shRNA Plasmid DNA
caudal type homeobox 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-877s1c1
Sequence:CCGGGTTTCACTTTAGTCGATACATCTCGAGATGTATCGACTAAAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-833s1c1
Sequence:CCGGCGGGTGGTGTACACAGACCATCTCGAGATGGTCTGTGTACACCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-751s1c1
Sequence:CCGGGCGAAACCTGTGCGAGTGGATCTCGAGATCCACTCGCACAGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-620s1c1
Sequence:CCGGCCGCATCATCACCCGCACCATCTCGAGATGGTGCGGGTGATGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-937s1c1
Sequence:CCGGGCTCTCCGAGAGGCAGGTTAACTCGAGTTAACCTGCCTCTCGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007673.3-789s21c1
Sequence:CCGGGTCCCTAGGAAGCCAAGTGAACTCGAGTTCACTTGGCTTCCTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007673.3-1260s21c1
Sequence:CCGGAGTATGGACGCTGCGAGAATCCTCGAGGATTCTCGCAGCGTCCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007673
CDX2 MISSION shRNA Lentiviral Transduction Particles
caudal type homeobox 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-877s1c1
Sequence:CCGGGTTTCACTTTAGTCGATACATCTCGAGATGTATCGACTAAAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-833s1c1
Sequence:CCGGCGGGTGGTGTACACAGACCATCTCGAGATGGTCTGTGTACACCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-751s1c1
Sequence:CCGGGCGAAACCTGTGCGAGTGGATCTCGAGATCCACTCGCACAGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-620s1c1
Sequence:CCGGCCGCATCATCACCCGCACCATCTCGAGATGGTGCGGGTGATGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007673.2-937s1c1
Sequence:CCGGGCTCTCCGAGAGGCAGGTTAACTCGAGTTAACCTGCCTCTCGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007673.3-789s21c1
Sequence:CCGGGTCCCTAGGAAGCCAAGTGAACTCGAGTTCACTTGGCTTCCTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007673.3-1260s21c1
Sequence:CCGGAGTATGGACGCTGCGAGAATCCTCGAGGATTCTCGCAGCGTCCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks