EMAIL THIS PAGE TO A FRIEND

CDX4

caudal type homeobox 4

58 Gene Product Result for
UniProtKB ID: O14627, A1A513, Q5JS20
Gene ID:
Human(1046) Summary: This gene encodes a member of a small subfamily of homeobox containing transcription factors. The encoded protein may regulate homeobox gene expression during anteroposterior patterning and hematopoiesis. [provided by RefSeq, Aug 2012]
Mouse(12592) caudal type homeobox 4
Rat(302400) caudal type homeo box 4
sheep(101111777) caudal type homeobox 4
Zebrafish(798281) caudal type homeo box transcription factor 4
cow(519648) caudal type homeobox 4
dog(491960) caudal type homeobox 4
chicken(395320) caudal type homeobox 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C7122 Anti-CDX4 (231-245) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV32765 Anti-CDX4 (AB1) antibody produced in rabbit affinity isolated antibody mouse, horse, rat, bovine, human, rabbit
immunohistochemistry, western blot pricing
AV31478 Anti-CDX4 (AB2) antibody produced in rabbit affinity isolated antibody rat, mouse, guinea pig, bovine, human, horse, canine, zebrafish, pig, rabbit
immunohistochemistry, western blot pricing
HPA056528 Anti-CDX4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2105246 Anti-CDX4, (C-terminal) antibody produced in rabbit affinity isolated antibody rabbit, mouse, horse
western blot pricing
WH0001046M1 Monoclonal Anti-CDX4 antibody produced in mouse clone 1G12, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB1403663 Monoclonal Anti-CDX4 antibody produced in mouse clone 3F3, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB1408763 Monoclonal Anti-CDX4 antibody produced in mouse clone 2E11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408764 Monoclonal Anti-CDX4 antibody produced in mouse clone 2G12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408765 Monoclonal Anti-CDX4 antibody produced in mouse clone 3H3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408766 Monoclonal Anti-CDX4 antibody produced in mouse clone 1A11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408767 Monoclonal Anti-CDX4 antibody produced in mouse clone 2F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408768 Monoclonal Anti-CDX4 antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408769 Monoclonal Anti-CDX4 antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408770 Monoclonal Anti-CDX4 antibody produced in mouse clone 1H7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408771 Monoclonal Anti-CDX4 antibody produced in mouse clone 3F11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408772 Monoclonal Anti-CDX4 antibody produced in mouse clone 1E11, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005193 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017661 MISSION® esiRNA esiRNA targeting mouse Cdx4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005193 Rosetta Predictions human pricing
NM_001106942 Rosetta Predictions rat pricing
NM_007674 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184821 predicted 630
2 SASI_Hs01_00184822 predicted 619
3 SASI_Hs01_00184823 predicted 245
4 SASI_Hs02_00339143 predicted 520
5 SASI_Hs01_00184824 predicted 260
6 SASI_Hs02_00339144 predicted 314
7 SASI_Hs01_00184826 predicted 228
8 SASI_Hs01_00184827 predicted 538
9 SASI_Hs01_00184828 predicted 529
10 SASI_Hs02_00339145 predicted 311
11 SASI_Hs01_00184820 predicted 257
12 SASI_Hs01_00184825 predicted 289
13 SASI_Hs01_00184829 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223926 predicted 1272
2 SASI_Rn02_00223927 predicted 1009
3 SASI_Rn02_00223928 predicted 999
4 SASI_Rn02_00223929 predicted 1108
5 SASI_Rn02_00223930 predicted 749
6 SASI_Rn02_00223931 predicted 1173
7 SASI_Rn02_00223932 predicted 1309
8 SASI_Rn02_00223933 predicted 1179
9 SASI_Rn02_00223934 predicted 1129
10 SASI_Rn02_00223935 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125828 predicted 984
2 SASI_Mm01_00125829 predicted 1261
3 SASI_Mm01_00125830 predicted 974
4 SASI_Mm01_00125831 predicted 1186
5 SASI_Mm01_00125832 predicted 1148
6 SASI_Mm01_00125833 predicted 1191
7 SASI_Mm01_00125834 predicted 920
8 SASI_Mm01_00125835 predicted 1085
9 SASI_Mm01_00125836 predicted 1080
10 SASI_Mm01_00125837 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007674
CDX4 MISSION shRNA Bacterial Glycerol Stock
caudal type homeobox 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007674.3-1359s21c1
Sequence:CCGGAGGAGTAAAGTAAGCATAAATCTCGAGATTTATGCTTACTTTACTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007674.3-689s21c1
Sequence:CCGGTGGTCTACACAGATCATCAACCTCGAGGTTGATGATCTGTGTAGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007674.3-953s21c1
Sequence:CCGGCATCTGCTGTCCGTGGATTTCCTCGAGGAAATCCACGGACAGCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-738s1c1
Sequence:CCGGCTGCAATAGATACATCACCATCTCGAGATGGTGATGTATCTATTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-991s1c1
Sequence:CCGGCAGCAGGTCATAGTTTCTGAACTCGAGTTCAGAAACTATGACCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-321s1c1
Sequence:CCGGCTACGTGGGTTACCCTCATATCTCGAGATATGAGGGTAACCCACGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-556s1c1
Sequence:CCGGAGCGAGTCACTGGTTTCTCTTCTCGAGAAGAGAAACCAGTGACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-402s1c1
Sequence:CCGGCCGGGAAGACTGGAGTACATACTCGAGTATGTACTCCAGTCTTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007674
CDX4 MISSION shRNA shRNA Plasmid DNA
caudal type homeobox 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007674.3-1359s21c1
Sequence:CCGGAGGAGTAAAGTAAGCATAAATCTCGAGATTTATGCTTACTTTACTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007674.3-689s21c1
Sequence:CCGGTGGTCTACACAGATCATCAACCTCGAGGTTGATGATCTGTGTAGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007674.3-953s21c1
Sequence:CCGGCATCTGCTGTCCGTGGATTTCCTCGAGGAAATCCACGGACAGCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-738s1c1
Sequence:CCGGCTGCAATAGATACATCACCATCTCGAGATGGTGATGTATCTATTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-991s1c1
Sequence:CCGGCAGCAGGTCATAGTTTCTGAACTCGAGTTCAGAAACTATGACCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-321s1c1
Sequence:CCGGCTACGTGGGTTACCCTCATATCTCGAGATATGAGGGTAACCCACGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-556s1c1
Sequence:CCGGAGCGAGTCACTGGTTTCTCTTCTCGAGAAGAGAAACCAGTGACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-402s1c1
Sequence:CCGGCCGGGAAGACTGGAGTACATACTCGAGTATGTACTCCAGTCTTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007674
CDX4 MISSION shRNA Lentiviral Transduction Particles
caudal type homeobox 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007674.3-1359s21c1
Sequence:CCGGAGGAGTAAAGTAAGCATAAATCTCGAGATTTATGCTTACTTTACTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007674.3-689s21c1
Sequence:CCGGTGGTCTACACAGATCATCAACCTCGAGGTTGATGATCTGTGTAGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007674.3-953s21c1
Sequence:CCGGCATCTGCTGTCCGTGGATTTCCTCGAGGAAATCCACGGACAGCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-738s1c1
Sequence:CCGGCTGCAATAGATACATCACCATCTCGAGATGGTGATGTATCTATTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-991s1c1
Sequence:CCGGCAGCAGGTCATAGTTTCTGAACTCGAGTTCAGAAACTATGACCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-321s1c1
Sequence:CCGGCTACGTGGGTTACCCTCATATCTCGAGATATGAGGGTAACCCACGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-556s1c1
Sequence:CCGGAGCGAGTCACTGGTTTCTCTTCTCGAGAAGAGAAACCAGTGACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007674.1-402s1c1
Sequence:CCGGCCGGGAAGACTGGAGTACATACTCGAGTATGTACTCCAGTCTTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005193
CDX4 MISSION shRNA Bacterial Glycerol Stock
caudal type homeobox 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005193.1-524s21c1
Sequence:CCGGAGTATCGTGTAGTTTACACTGCTCGAGCAGTGTAAACTACACGATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005193.1-268s21c1
Sequence:CCGGTCTAGTACAATGGGCACAGTGCTCGAGCACTGTGCCCATTGTACTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-547s1c1
Sequence:CCGGCATCAAAGATTGGAGCTGGAACTCGAGTTCCAGCTCCAATCTTTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-318s1c1
Sequence:CCGGCGCTTTCTGCTCGACCGACTACTCGAGTAGTCGGTCGAGCAGAAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-634s1c1
Sequence:CCGGCTTTCCGAGAGACAGGTGAAACTCGAGTTTCACCTGTCTCTCGGAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-141s1c1
Sequence:CCGGACCGGCTTTCTCGCACTATATCTCGAGATATAGTGCGAGAAAGCCGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-237s1c1
Sequence:CCGGGCGAGAAGACTGGAGCGTGTACTCGAGTACACGCTCCAGTCTTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005193
CDX4 MISSION shRNA shRNA Plasmid DNA
caudal type homeobox 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005193.1-524s21c1
Sequence:CCGGAGTATCGTGTAGTTTACACTGCTCGAGCAGTGTAAACTACACGATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005193.1-268s21c1
Sequence:CCGGTCTAGTACAATGGGCACAGTGCTCGAGCACTGTGCCCATTGTACTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-547s1c1
Sequence:CCGGCATCAAAGATTGGAGCTGGAACTCGAGTTCCAGCTCCAATCTTTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-318s1c1
Sequence:CCGGCGCTTTCTGCTCGACCGACTACTCGAGTAGTCGGTCGAGCAGAAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-634s1c1
Sequence:CCGGCTTTCCGAGAGACAGGTGAAACTCGAGTTTCACCTGTCTCTCGGAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-141s1c1
Sequence:CCGGACCGGCTTTCTCGCACTATATCTCGAGATATAGTGCGAGAAAGCCGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-237s1c1
Sequence:CCGGGCGAGAAGACTGGAGCGTGTACTCGAGTACACGCTCCAGTCTTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005193
CDX4 MISSION shRNA Lentiviral Transduction Particles
caudal type homeobox 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005193.1-524s21c1
Sequence:CCGGAGTATCGTGTAGTTTACACTGCTCGAGCAGTGTAAACTACACGATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005193.1-268s21c1
Sequence:CCGGTCTAGTACAATGGGCACAGTGCTCGAGCACTGTGCCCATTGTACTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-547s1c1
Sequence:CCGGCATCAAAGATTGGAGCTGGAACTCGAGTTCCAGCTCCAATCTTTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-318s1c1
Sequence:CCGGCGCTTTCTGCTCGACCGACTACTCGAGTAGTCGGTCGAGCAGAAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-634s1c1
Sequence:CCGGCTTTCCGAGAGACAGGTGAAACTCGAGTTTCACCTGTCTCTCGGAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-141s1c1
Sequence:CCGGACCGGCTTTCTCGCACTATATCTCGAGATATAGTGCGAGAAAGCCGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005193.1-237s1c1
Sequence:CCGGGCGAGAAGACTGGAGCGTGTACTCGAGTACACGCTCCAGTCTTCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)