EMAIL THIS PAGE TO A FRIEND

CDY1

chromodomain protein, Y-linked, 1

30 Gene Product Result for
Synonyms: CDY CDY1A
Species: Human CDY1(9085)
UniProtKB ID: Q9Y6F8, A2RUK1, O14600
Gene ID:
Human(9085) Summary: This gene encodes a protein containing a chromodomain and a histone acetyltransferase catalytic domain. Chromodomain proteins are components of heterochromatin-like complexes and can act as gene repressors. This protein is localized to the nucleus of late spermatids where histone hyperacetylation takes place. Histone hyperacetylation is thought to facilitate the transition in which protamines replace histones as the major DNA-packaging protein. The human chromosome Y has two identical copies of this gene within a palindromic region; this record represents the more telomeric copy. Chromosome Y also contains a pair of closely related genes in another more telomeric palindrome as well as several related pseudogenes. Two protein isoforms are encoded by transcript variants of this gene. Additional transcript variants have been described, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV48645 Anti-CDY1 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, mouse, human, horse, rat
western blot pricing
SAB1305230 ANTI-CDY1(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004680 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004680 Rosetta Predictions human pricing
NM_170723 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205695 predicted 1210
2 SASI_Hs01_00205696 predicted 1005
3 SASI_Hs01_00205697 predicted 797
4 SASI_Hs01_00205698 predicted 522
5 SASI_Hs01_00205699 predicted 1196
6 SASI_Hs01_00205700 predicted 1524
7 SASI_Hs01_00205701 predicted 1627
8 SASI_Hs02_00338112 predicted 1281
9 SASI_Hs01_00205702 predicted 1046
10 SASI_Hs01_00205703 predicted 920
11 SASI_Hs01_00205704 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113657 predicted 1211
2 SASI_Hs01_00113658 predicted 1004
3 SASI_Hs01_00113659 predicted 797
4 SASI_Hs01_00113660 predicted 524
5 SASI_Hs01_00113661 predicted 1203
6 SASI_Hs01_00113662 predicted 1524
7 SASI_Hs01_00113663 predicted 1624
8 SASI_Hs02_00367681 predicted 1287
9 SASI_Hs01_00113664 predicted 1051
10 SASI_Hs01_00113665 predicted 922
11 SASI_Hs01_00113666 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004680
CDY1 MISSION shRNA Bacterial Glycerol Stock
chromodomain protein, Y-linked, 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004680.2-2079s1c1
Sequence:CCGGCGATCATTCTCCTAAACTGAACTCGAGTTCAGTTTAGGAGAATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004680.2-405s1c1
Sequence:CCGGCGGTGGAAAGGTTATGACAAACTCGAGTTTGTCATAACCTTTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004680.2-999s1c1
Sequence:CCGGCGAAAGGGTATAGTGGTATTACTCGAGTAATACCACTATACCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004680.2-1469s1c1
Sequence:CCGGGCCTATTGTTGTATCAGTCAACTCGAGTTGACTGATACAACAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004680.2-1531s21c1
Sequence:CCGGGTGATCTCGTGTGGGCTAATGCTCGAGCATTAGCCCACACGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004680.2-1742s21c1
Sequence:CCGGCCAAGAGGTTATGATTCAAATCTCGAGATTTGAATCATAACCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004680
CDY1 MISSION shRNA shRNA Plasmid DNA
chromodomain protein, Y-linked, 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004680.2-2079s1c1
Sequence:CCGGCGATCATTCTCCTAAACTGAACTCGAGTTCAGTTTAGGAGAATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004680.2-405s1c1
Sequence:CCGGCGGTGGAAAGGTTATGACAAACTCGAGTTTGTCATAACCTTTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004680.2-999s1c1
Sequence:CCGGCGAAAGGGTATAGTGGTATTACTCGAGTAATACCACTATACCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004680.2-1469s1c1
Sequence:CCGGGCCTATTGTTGTATCAGTCAACTCGAGTTGACTGATACAACAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004680.2-1531s21c1
Sequence:CCGGGTGATCTCGTGTGGGCTAATGCTCGAGCATTAGCCCACACGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004680.2-1742s21c1
Sequence:CCGGCCAAGAGGTTATGATTCAAATCTCGAGATTTGAATCATAACCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004680
CDY1 MISSION shRNA Lentiviral Transduction Particles
chromodomain protein, Y-linked, 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004680.2-2079s1c1
Sequence:CCGGCGATCATTCTCCTAAACTGAACTCGAGTTCAGTTTAGGAGAATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004680.2-405s1c1
Sequence:CCGGCGGTGGAAAGGTTATGACAAACTCGAGTTTGTCATAACCTTTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004680.2-999s1c1
Sequence:CCGGCGAAAGGGTATAGTGGTATTACTCGAGTAATACCACTATACCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004680.2-1469s1c1
Sequence:CCGGGCCTATTGTTGTATCAGTCAACTCGAGTTGACTGATACAACAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004680.2-1531s21c1
Sequence:CCGGGTGATCTCGTGTGGGCTAATGCTCGAGCATTAGCCCACACGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004680.2-1742s21c1
Sequence:CCGGCCAAGAGGTTATGATTCAAATCTCGAGATTTGAATCATAACCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks