EMAIL THIS PAGE TO A FRIEND

CDY1B

chromodomain protein, Y-linked, 1B

51 Gene Product Result for
Synonyms: CDY
Species: Human CDY1B(253175)
Gene ID:
Human(253175) Summary: This gene encodes a protein containing a chromodomain and a histone acetyltransferase catalytic domain. Chromodomain proteins are components of heterochromatin-like complexes and can act as gene repressors. This protein is localized to the nucleus of late spermatids where histone hyperacetylation takes place. Histone hyperacetylation is thought to facilitate the transition in which protamines replace histones as the major DNA-packaging protein. The human chromosome Y has two identical copies of this gene within a palindromic region; this record represents the more centromeric copy. Chromosome Y also contains a pair of closely related genes in another more telomeric palindrome as well as several related pseudogenes. Two protein isoforms are encoded by transcript variants of this gene. Additional transcript variants have been described, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003894 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003894 Rosetta Predictions human pricing
NM_001003895 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089750 predicted 1218
2 SASI_Hs01_00089751 predicted 1011
3 SASI_Hs01_00089752 predicted 803
4 SASI_Hs01_00089753 predicted 520
5 SASI_Hs01_00089754 predicted 1198
6 SASI_Hs01_00089755 predicted 1527
7 SASI_Hs01_00089756 predicted 1631
8 SASI_Hs02_00304419 predicted 1287
9 SASI_Hs01_00089757 predicted 1048
10 SASI_Hs01_00089758 predicted 922
11 SASI_Hs01_00089759 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191834 predicted 1214
2 SASI_Hs01_00191835 predicted 1005
3 SASI_Hs01_00191836 predicted 801
4 SASI_Hs01_00191837 predicted 519
5 SASI_Hs01_00191838 predicted 1197
6 SASI_Hs01_00191839 predicted 1523
7 SASI_Hs01_00191840 predicted 1625
8 SASI_Hs02_00304420 predicted 1284
9 SASI_Hs01_00191841 predicted 1048
10 SASI_Hs01_00191842 predicted 924
11 SASI_Hs01_00191843 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003894
CDY1B MISSION shRNA Bacterial Glycerol Stock
chromodomain protein, Y-linked, 1B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-1741s1c1
Sequence:CCGGCCCAAGAGGTTATGATTCAAACTCGAGTTTGAATCATAACCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-1069s1c1
Sequence:CCGGCAAGAGTGAAAGGTGGGCAAACTCGAGTTTGCCCACCTTTCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-652s1c1
Sequence:CCGGGCAAGTTATTTGCTGCCAGCACTCGAGTGCTGGCAGCAAATAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-1072s1c1
Sequence:CCGGGAGTGAAAGGTGGGCAAAGAACTCGAGTTCTTTGCCCACCTTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-1631s1c1
Sequence:CCGGGATGGGTAAAGCATCTGCCAACTCGAGTTGGCAGATGCTTTACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-559s1c1
Sequence:CCGGCCAGAAGAAGAACTTCCAGATCTCGAGATCTGGAAGTTCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003894.1-2062s1c1
Sequence:CCGGGCTTGGAAACAGAACTGGAAACTCGAGTTTCCAGTTCTGTTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003894.1-2012s1c1
Sequence:CCGGGATGCCCTAATCCATCTTCATCTCGAGATGAAGATGGATTAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-1641s1c1
Sequence:CCGGGCATCTGCCAATGAAATGTTACTCGAGTAACATTTCATTGGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-707s1c1
Sequence:CCGGCGACACAAAGAATATGGAGATCTCGAGATCTCCATATTCTTTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003894
CDY1B MISSION shRNA shRNA Plasmid DNA
chromodomain protein, Y-linked, 1B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-1741s1c1
Sequence:CCGGCCCAAGAGGTTATGATTCAAACTCGAGTTTGAATCATAACCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-1069s1c1
Sequence:CCGGCAAGAGTGAAAGGTGGGCAAACTCGAGTTTGCCCACCTTTCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-652s1c1
Sequence:CCGGGCAAGTTATTTGCTGCCAGCACTCGAGTGCTGGCAGCAAATAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-1072s1c1
Sequence:CCGGGAGTGAAAGGTGGGCAAAGAACTCGAGTTCTTTGCCCACCTTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-1631s1c1
Sequence:CCGGGATGGGTAAAGCATCTGCCAACTCGAGTTGGCAGATGCTTTACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-559s1c1
Sequence:CCGGCCAGAAGAAGAACTTCCAGATCTCGAGATCTGGAAGTTCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003894.1-2062s1c1
Sequence:CCGGGCTTGGAAACAGAACTGGAAACTCGAGTTTCCAGTTCTGTTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003894.1-2012s1c1
Sequence:CCGGGATGCCCTAATCCATCTTCATCTCGAGATGAAGATGGATTAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-1641s1c1
Sequence:CCGGGCATCTGCCAATGAAATGTTACTCGAGTAACATTTCATTGGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-707s1c1
Sequence:CCGGCGACACAAAGAATATGGAGATCTCGAGATCTCCATATTCTTTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003894
CDY1B MISSION shRNA Lentiviral Transduction Particles
chromodomain protein, Y-linked, 1B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-1741s1c1
Sequence:CCGGCCCAAGAGGTTATGATTCAAACTCGAGTTTGAATCATAACCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-1069s1c1
Sequence:CCGGCAAGAGTGAAAGGTGGGCAAACTCGAGTTTGCCCACCTTTCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-652s1c1
Sequence:CCGGGCAAGTTATTTGCTGCCAGCACTCGAGTGCTGGCAGCAAATAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-1072s1c1
Sequence:CCGGGAGTGAAAGGTGGGCAAAGAACTCGAGTTCTTTGCCCACCTTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-1631s1c1
Sequence:CCGGGATGGGTAAAGCATCTGCCAACTCGAGTTGGCAGATGCTTTACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-559s1c1
Sequence:CCGGCCAGAAGAAGAACTTCCAGATCTCGAGATCTGGAAGTTCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003894.1-2062s1c1
Sequence:CCGGGCTTGGAAACAGAACTGGAAACTCGAGTTTCCAGTTCTGTTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003894.1-2012s1c1
Sequence:CCGGGATGCCCTAATCCATCTTCATCTCGAGATGAAGATGGATTAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003894.1-1641s1c1
Sequence:CCGGGCATCTGCCAATGAAATGTTACTCGAGTAACATTTCATTGGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003894.1-707s1c1
Sequence:CCGGCGACACAAAGAATATGGAGATCTCGAGATCTCCATATTCTTTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks