EMAIL THIS PAGE TO A FRIEND

CDY2A

chromodomain protein, Y-linked, 2A

16 Gene Product Result for
Synonyms: CDY CDY2
Species: Human CDY2A(9426)
UniProtKB ID: Q9Y6F7, A8K868
Gene ID:
Human(9426) Summary: This intronless gene encodes a protein containing a chromodomain and a histone acetyltransferase catalytic domain. Chromodomain proteins are components of heterochromatin-like complexes and can act as gene repressors. This protein is localized to the nucleus of late spermatids where histone hyperacetylation takes place. Histone hyperacetylation is thought to facilitate the transition in which protamines replace histones as the major DNA-packaging protein. Two nearly identical copies of this gene are found in a palindromic region on chromosome Y; this record represents the telomeric copy. Chromosome Y also contains a pair of closely related genes in another more telomeric palindrome as well as several related pseudogenes. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004825 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004825 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030479 predicted 1267
2 SASI_Hs01_00030480 predicted 1224
3 SASI_Hs01_00030481 predicted 1012
4 SASI_Hs01_00030482 predicted 806
5 SASI_Hs01_00030483 predicted 523
6 SASI_Hs01_00030484 predicted 1201
7 SASI_Hs01_00030485 predicted 1531
8 SASI_Hs01_00030486 predicted 1631
9 SASI_Hs01_00030487 predicted 1287
10 SASI_Hs01_00030488 predicted 1055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004825
CDY2A MISSION shRNA Bacterial Glycerol Stock
chromodomain protein, Y-linked, 2A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-1074s1c1
Sequence:CCGGCAAGAGTGAAAGGTGGGCAAACTCGAGTTTGCCCACCTTTCACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-655s1c1
Sequence:CCGGCAAGTTATTTGCTGCCAGCAACTCGAGTTGCTGGCAGCAAATAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-1646s1c1
Sequence:CCGGGCATCTGCCAATGAAATGTTACTCGAGTAACATTTCATTGGCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-1475s1c1
Sequence:CCGGCCTATTGTTGTATCAGTCAATCTCGAGATTGACTGATACAACAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-1647s1c1
Sequence:CCGGCATCTGCCAATGAAATGTTAACTCGAGTTAACATTTCATTGGCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-1253s1c1
Sequence:CCGGGCACTGAATACAGAAGTAATTCTCGAGAATTACTTCTGTATTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-709s1c1
Sequence:CCGGCGACACAAAGAATATGGAGATCTCGAGATCTCCATATTCTTTGTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-561s1c1
Sequence:CCGGCCAGAAGAAGAACTTCCAGATCTCGAGATCTGGAAGTTCTTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-1003s1c1
Sequence:CCGGCCGAAAGGGTATAGTGGTATTCTCGAGAATACCACTATACCCTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004825
CDY2A MISSION shRNA shRNA Plasmid DNA
chromodomain protein, Y-linked, 2A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-1074s1c1
Sequence:CCGGCAAGAGTGAAAGGTGGGCAAACTCGAGTTTGCCCACCTTTCACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-655s1c1
Sequence:CCGGCAAGTTATTTGCTGCCAGCAACTCGAGTTGCTGGCAGCAAATAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-1646s1c1
Sequence:CCGGGCATCTGCCAATGAAATGTTACTCGAGTAACATTTCATTGGCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-1475s1c1
Sequence:CCGGCCTATTGTTGTATCAGTCAATCTCGAGATTGACTGATACAACAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-1647s1c1
Sequence:CCGGCATCTGCCAATGAAATGTTAACTCGAGTTAACATTTCATTGGCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-1253s1c1
Sequence:CCGGGCACTGAATACAGAAGTAATTCTCGAGAATTACTTCTGTATTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-709s1c1
Sequence:CCGGCGACACAAAGAATATGGAGATCTCGAGATCTCCATATTCTTTGTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-561s1c1
Sequence:CCGGCCAGAAGAAGAACTTCCAGATCTCGAGATCTGGAAGTTCTTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-1003s1c1
Sequence:CCGGCCGAAAGGGTATAGTGGTATTCTCGAGAATACCACTATACCCTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004825
CDY2A MISSION shRNA Lentiviral Transduction Particles
chromodomain protein, Y-linked, 2A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-1074s1c1
Sequence:CCGGCAAGAGTGAAAGGTGGGCAAACTCGAGTTTGCCCACCTTTCACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-655s1c1
Sequence:CCGGCAAGTTATTTGCTGCCAGCAACTCGAGTTGCTGGCAGCAAATAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-1646s1c1
Sequence:CCGGGCATCTGCCAATGAAATGTTACTCGAGTAACATTTCATTGGCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-1475s1c1
Sequence:CCGGCCTATTGTTGTATCAGTCAATCTCGAGATTGACTGATACAACAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-1647s1c1
Sequence:CCGGCATCTGCCAATGAAATGTTAACTCGAGTTAACATTTCATTGGCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-1253s1c1
Sequence:CCGGGCACTGAATACAGAAGTAATTCTCGAGAATTACTTCTGTATTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004825.2-709s1c1
Sequence:CCGGCGACACAAAGAATATGGAGATCTCGAGATCTCCATATTCTTTGTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-561s1c1
Sequence:CCGGCCAGAAGAAGAACTTCCAGATCTCGAGATCTGGAAGTTCTTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004825.2-1003s1c1
Sequence:CCGGCCGAAAGGGTATAGTGGTATTCTCGAGAATACCACTATACCCTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)