EMAIL THIS PAGE TO A FRIEND

CDY2B

chromodomain protein, Y-linked, 2B

Synonyms: CDY
Species: Human CDY2B(203611)
Gene ID:
Human(203611) Summary: This intronless gene encodes a protein containing a chromodomain and a histone acetyltransferase catalytic domain. Chromodomain proteins are components of heterochromatin-like complexes and can act as gene repressors. This protein is localized to the nucleus of late spermatids where histone hyperacetylation takes place. Histone hyperacetylation is thought to facilitate the transition in which protamines replace histones as the major DNA-packaging protein. Two nearly identical copies of this gene are found in a palindromic region on chromosome Y; this record represents the centromeric copy. Chromosome Y also contains a pair of closely related genes in another more telomeric palindrome as well as several related pseudogenes. [provided by RefSeq, Jul 2008]
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001722 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001722 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118338 predicted 1262
2 SASI_Hs01_00118339 predicted 1215
3 SASI_Hs01_00118340 predicted 1016
4 SASI_Hs01_00118341 predicted 807
5 SASI_Hs01_00118342 predicted 525
6 SASI_Hs01_00118343 predicted 1207
7 SASI_Hs01_00118344 predicted 1525
8 SASI_Hs01_00118345 predicted 1632
9 SASI_Hs01_00118346 predicted 1287
10 SASI_Hs01_00118347 predicted 1054
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001722
CDY2B MISSION shRNA Bacterial Glycerol Stock
chromodomain protein, Y-linked, 2B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1073s1c1
Sequence:CCGGCAAGAGTGAAAGGTGGGCAAACTCGAGTTTGCCCACCTTTCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1801s1c1
Sequence:CCGGGAAGAATGTAAGGCCCTCGTTCTCGAGAACGAGGGCCTTACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1635s1c1
Sequence:CCGGGATGGGTAAAGCATCTGCCAACTCGAGTTGGCAGATGCTTTACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-451s1c1
Sequence:CCGGCAGCACCTCATGAACTGTGAACTCGAGTTCACAGTTCATGAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-560s1c1
Sequence:CCGGCCAGAAGAAGAACTTCCAGATCTCGAGATCTGGAAGTTCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1168s1c1
Sequence:CCGGGCCATCACATACAGAGACATTCTCGAGAATGTCTCTGTATGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1601s1c1
Sequence:CCGGCAGATGGCTGTTCTTCTATTACTCGAGTAATAGAAGAACAGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1224s1c1
Sequence:CCGGGCTATCAACTAGATCGACAGACTCGAGTCTGTCGATCTAGTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-628s1c1
Sequence:CCGGGATAAACACCACAGGTCCAAACTCGAGTTTGGACCTGTGGTGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1403s1c1
Sequence:CCGGGAAACACAGCAAGCCTTGAAACTCGAGTTTCAAGGCTTGCTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1773s1c1
Sequence:CCGGGCTTGCCTCATACAATGCAATCTCGAGATTGCATTGTATGAGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001722
CDY2B MISSION shRNA shRNA Plasmid DNA
chromodomain protein, Y-linked, 2B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1073s1c1
Sequence:CCGGCAAGAGTGAAAGGTGGGCAAACTCGAGTTTGCCCACCTTTCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1801s1c1
Sequence:CCGGGAAGAATGTAAGGCCCTCGTTCTCGAGAACGAGGGCCTTACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1635s1c1
Sequence:CCGGGATGGGTAAAGCATCTGCCAACTCGAGTTGGCAGATGCTTTACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-451s1c1
Sequence:CCGGCAGCACCTCATGAACTGTGAACTCGAGTTCACAGTTCATGAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-560s1c1
Sequence:CCGGCCAGAAGAAGAACTTCCAGATCTCGAGATCTGGAAGTTCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1168s1c1
Sequence:CCGGGCCATCACATACAGAGACATTCTCGAGAATGTCTCTGTATGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1601s1c1
Sequence:CCGGCAGATGGCTGTTCTTCTATTACTCGAGTAATAGAAGAACAGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1224s1c1
Sequence:CCGGGCTATCAACTAGATCGACAGACTCGAGTCTGTCGATCTAGTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-628s1c1
Sequence:CCGGGATAAACACCACAGGTCCAAACTCGAGTTTGGACCTGTGGTGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1403s1c1
Sequence:CCGGGAAACACAGCAAGCCTTGAAACTCGAGTTTCAAGGCTTGCTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1773s1c1
Sequence:CCGGGCTTGCCTCATACAATGCAATCTCGAGATTGCATTGTATGAGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001722
CDY2B MISSION shRNA Lentiviral Transduction Particles
chromodomain protein, Y-linked, 2B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1073s1c1
Sequence:CCGGCAAGAGTGAAAGGTGGGCAAACTCGAGTTTGCCCACCTTTCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1801s1c1
Sequence:CCGGGAAGAATGTAAGGCCCTCGTTCTCGAGAACGAGGGCCTTACATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1635s1c1
Sequence:CCGGGATGGGTAAAGCATCTGCCAACTCGAGTTGGCAGATGCTTTACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-451s1c1
Sequence:CCGGCAGCACCTCATGAACTGTGAACTCGAGTTCACAGTTCATGAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-560s1c1
Sequence:CCGGCCAGAAGAAGAACTTCCAGATCTCGAGATCTGGAAGTTCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1168s1c1
Sequence:CCGGGCCATCACATACAGAGACATTCTCGAGAATGTCTCTGTATGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1601s1c1
Sequence:CCGGCAGATGGCTGTTCTTCTATTACTCGAGTAATAGAAGAACAGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1224s1c1
Sequence:CCGGGCTATCAACTAGATCGACAGACTCGAGTCTGTCGATCTAGTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-628s1c1
Sequence:CCGGGATAAACACCACAGGTCCAAACTCGAGTTTGGACCTGTGGTGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001722.1-1403s1c1
Sequence:CCGGGAAACACAGCAAGCCTTGAAACTCGAGTTTCAAGGCTTGCTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001722.1-1773s1c1
Sequence:CCGGGCTTGCCTCATACAATGCAATCTCGAGATTGCATTGTATGAGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks