EMAIL THIS PAGE TO A FRIEND

CDYL2

chromodomain protein, Y-like 2

77 Gene Product Result for
Synonyms: PCCP1
UniProtKB ID: Q8N8U2, Q7Z5I8
Gene ID:
Mouse(75796) chromodomain protein, Y chromosome-like 2
Rat(292044) chromodomain protein, Y-like 2
naked mole-rat(101716343) chromodomain protein, Y-like 2
domestic guinea pig(100724991) chromodomain protein, Y-like 2
sheep(101119749) chromodomain protein, Y-like 2
Domestic Rabbit(100355782) chromodomain protein, Y-like 2
chicken(425886) chromodomain protein, Y-like 2
dog(489698) chromodomain protein, Y-like 2
domestic cat(101083820) chromodomain protein, Y-like 2
cow(536901) chromodomain protein, Y-like 2
Horse(100069707) chromodomain protein, Y-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029441 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029441 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029441 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152342 Rosetta Predictions human pricing
NM_001106189 Rosetta Predictions rat pricing
NM_029441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204517 predicted 807
2 SASI_Hs01_00204518 predicted 1466
3 SASI_Hs01_00204519 predicted 849
4 SASI_Hs02_00365960 predicted 673
5 SASI_Hs01_00204520 predicted 1120
6 SASI_Hs01_00204521 predicted 403
7 SASI_Hs01_00204522 predicted 640
8 SASI_Hs01_00204523 predicted 1030
9 SASI_Hs01_00204525 predicted 1045
10 SASI_Hs02_00365961 predicted 406
11 SASI_Hs01_00204524 predicted 673
12 SASI_Hs01_00204526 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216508 predicted 1083
2 SASI_Rn02_00216509 predicted 453
3 SASI_Rn02_00216510 predicted 714
4 SASI_Rn02_00216511 predicted 878
5 SASI_Rn02_00216512 predicted 983
6 SASI_Rn02_00216513 predicted 643
7 SASI_Rn02_00216514 predicted 491
8 SASI_Rn02_00216515 predicted 454
9 SASI_Rn02_00216516 predicted 574
10 SASI_Rn02_00216517 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057287 predicted 901
2 SASI_Mm01_00057288 predicted 1278
3 SASI_Mm01_00057290 predicted 1210
4 SASI_Mm01_00057291 predicted 643
5 SASI_Mm01_00057292 predicted 1831
6 SASI_Mm01_00057293 predicted 1805
7 SASI_Mm01_00057294 predicted 1033
8 SASI_Mm01_00057295 predicted 1028
9 SASI_Mm01_00057296 predicted 1158
10 SASI_Mm02_00335363 predicted 1129
11 SASI_Mm01_00057289 predicted 1506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152342
CDYL2 MISSION shRNA Bacterial Glycerol Stock
chromodomain protein, Y-like 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152342.2-1037s21c1
Sequence:CCGGTGGATTATTCCTACCTAATTGCTCGAGCAATTAGGTAGGAATAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152342.2-900s21c1
Sequence:CCGGGTCCAGTCAGACCTCGGATAACTCGAGTTATCCGAGGTCTGACTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152342.2-413s21c1
Sequence:CCGGCCCATAAACGGAAGCGAATTACTCGAGTAATTCGCTTCCGTTTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152342.2-2056s21c1
Sequence:CCGGACGACCAATCTTAGGGAATTTCTCGAGAAATTCCCTAAGATTGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152342.1-1908s1c1
Sequence:CCGGCCACTTGCTGAAATGCACCATCTCGAGATGGTGCATTTCAGCAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152342.1-175s1c1
Sequence:CCGGGAGTATCTTATCCGATGGAAACTCGAGTTTCCATCGGATAAGATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152342.1-610s1c1
Sequence:CCGGCACTTTGGAAATGGGTCCCATCTCGAGATGGGACCCATTTCCAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152342.1-294s1c1
Sequence:CCGGCAAGAGGATCAAGTCAGGGAACTCGAGTTCCCTGACTTGATCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152342.1-1708s1c1
Sequence:CCGGGAGTTTGTCAAGGTGTCTCTTCTCGAGAAGAGACACCTTGACAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152342.1-2065s1c1
Sequence:CCGGCTTAGGGAATTTCCAGACCAACTCGAGTTGGTCTGGAAATTCCCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152342.1-826s1c1
Sequence:CCGGCGCCAGAATGAAAGCAACTGTCTCGAGACAGTTGCTTTCATTCTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152342.1-414s1c1
Sequence:CCGGCCATAAACGGAAGCGAATTAACTCGAGTTAATTCGCTTCCGTTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152342
CDYL2 MISSION shRNA shRNA Plasmid DNA
chromodomain protein, Y-like 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152342.2-1037s21c1
Sequence:CCGGTGGATTATTCCTACCTAATTGCTCGAGCAATTAGGTAGGAATAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152342.2-900s21c1
Sequence:CCGGGTCCAGTCAGACCTCGGATAACTCGAGTTATCCGAGGTCTGACTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152342.2-413s21c1
Sequence:CCGGCCCATAAACGGAAGCGAATTACTCGAGTAATTCGCTTCCGTTTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152342.2-2056s21c1
Sequence:CCGGACGACCAATCTTAGGGAATTTCTCGAGAAATTCCCTAAGATTGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152342.1-1908s1c1
Sequence:CCGGCCACTTGCTGAAATGCACCATCTCGAGATGGTGCATTTCAGCAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152342.1-175s1c1
Sequence:CCGGGAGTATCTTATCCGATGGAAACTCGAGTTTCCATCGGATAAGATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152342.1-610s1c1
Sequence:CCGGCACTTTGGAAATGGGTCCCATCTCGAGATGGGACCCATTTCCAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152342.1-294s1c1
Sequence:CCGGCAAGAGGATCAAGTCAGGGAACTCGAGTTCCCTGACTTGATCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152342.1-1708s1c1
Sequence:CCGGGAGTTTGTCAAGGTGTCTCTTCTCGAGAAGAGACACCTTGACAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152342.1-2065s1c1
Sequence:CCGGCTTAGGGAATTTCCAGACCAACTCGAGTTGGTCTGGAAATTCCCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152342.1-826s1c1
Sequence:CCGGCGCCAGAATGAAAGCAACTGTCTCGAGACAGTTGCTTTCATTCTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152342.1-414s1c1
Sequence:CCGGCCATAAACGGAAGCGAATTAACTCGAGTTAATTCGCTTCCGTTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152342
CDYL2 MISSION shRNA Lentiviral Transduction Particles
chromodomain protein, Y-like 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152342.2-1037s21c1
Sequence:CCGGTGGATTATTCCTACCTAATTGCTCGAGCAATTAGGTAGGAATAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152342.2-900s21c1
Sequence:CCGGGTCCAGTCAGACCTCGGATAACTCGAGTTATCCGAGGTCTGACTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152342.2-413s21c1
Sequence:CCGGCCCATAAACGGAAGCGAATTACTCGAGTAATTCGCTTCCGTTTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152342.2-2056s21c1
Sequence:CCGGACGACCAATCTTAGGGAATTTCTCGAGAAATTCCCTAAGATTGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152342.1-1908s1c1
Sequence:CCGGCCACTTGCTGAAATGCACCATCTCGAGATGGTGCATTTCAGCAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152342.1-175s1c1
Sequence:CCGGGAGTATCTTATCCGATGGAAACTCGAGTTTCCATCGGATAAGATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152342.1-610s1c1
Sequence:CCGGCACTTTGGAAATGGGTCCCATCTCGAGATGGGACCCATTTCCAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152342.1-294s1c1
Sequence:CCGGCAAGAGGATCAAGTCAGGGAACTCGAGTTCCCTGACTTGATCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152342.1-1708s1c1
Sequence:CCGGGAGTTTGTCAAGGTGTCTCTTCTCGAGAAGAGACACCTTGACAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152342.1-2065s1c1
Sequence:CCGGCTTAGGGAATTTCCAGACCAACTCGAGTTGGTCTGGAAATTCCCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152342.1-826s1c1
Sequence:CCGGCGCCAGAATGAAAGCAACTGTCTCGAGACAGTTGCTTTCATTCTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152342.1-414s1c1
Sequence:CCGGCCATAAACGGAAGCGAATTAACTCGAGTTAATTCGCTTCCGTTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029441
CDYL2 MISSION shRNA Bacterial Glycerol Stock
chromodomain protein, Y-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029441.2-2261s1c1
Sequence:CCGGGATTTACAAACCCAGATATTGCTCGAGCAATATCTGGGTTTGTAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029441.2-231s1c1
Sequence:CCGGGGGAAATGGGAATATCTTATCCTCGAGGATAAGATATTCCCATTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029441.2-2230s1c1
Sequence:CCGGCTTAGGGCTTGGTCTTAATACCTCGAGGTATTAAGACCAAGCCCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029441.2-2245s21c1
Sequence:CCGGTAATACCCAACTGAGTGATTTCTCGAGAAATCACTCAGTTGGGTATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-956s21c1
Sequence:CCGGGTCCAGCCAGACTTCGGATAACTCGAGTTATCCGAAGTCTGGCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-1081s21c1
Sequence:CCGGTCTGCAGCGGACTAGACTATTCTCGAGAATAGTCTAGTCCGCTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-1203s21c1
Sequence:CCGGCCCATCGTGGTAGCCATTAATCTCGAGATTAATGGCTACCACGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-305s21c1
Sequence:CCGGCCTGCACTGTGAGGAGTTTATCTCGAGATAAACTCCTCACAGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029441.1-741s1c1
Sequence:CCGGGAATGAAAGCAACTGTCGGTTCTCGAGAACCGACAGTTGCTTTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029441
CDYL2 MISSION shRNA shRNA Plasmid DNA
chromodomain protein, Y-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029441.2-2261s1c1
Sequence:CCGGGATTTACAAACCCAGATATTGCTCGAGCAATATCTGGGTTTGTAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029441.2-231s1c1
Sequence:CCGGGGGAAATGGGAATATCTTATCCTCGAGGATAAGATATTCCCATTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029441.2-2230s1c1
Sequence:CCGGCTTAGGGCTTGGTCTTAATACCTCGAGGTATTAAGACCAAGCCCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029441.2-2245s21c1
Sequence:CCGGTAATACCCAACTGAGTGATTTCTCGAGAAATCACTCAGTTGGGTATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-956s21c1
Sequence:CCGGGTCCAGCCAGACTTCGGATAACTCGAGTTATCCGAAGTCTGGCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-1081s21c1
Sequence:CCGGTCTGCAGCGGACTAGACTATTCTCGAGAATAGTCTAGTCCGCTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-1203s21c1
Sequence:CCGGCCCATCGTGGTAGCCATTAATCTCGAGATTAATGGCTACCACGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-305s21c1
Sequence:CCGGCCTGCACTGTGAGGAGTTTATCTCGAGATAAACTCCTCACAGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029441.1-741s1c1
Sequence:CCGGGAATGAAAGCAACTGTCGGTTCTCGAGAACCGACAGTTGCTTTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029441
CDYL2 MISSION shRNA Lentiviral Transduction Particles
chromodomain protein, Y-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029441.2-2261s1c1
Sequence:CCGGGATTTACAAACCCAGATATTGCTCGAGCAATATCTGGGTTTGTAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029441.2-231s1c1
Sequence:CCGGGGGAAATGGGAATATCTTATCCTCGAGGATAAGATATTCCCATTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029441.2-2230s1c1
Sequence:CCGGCTTAGGGCTTGGTCTTAATACCTCGAGGTATTAAGACCAAGCCCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029441.2-2245s21c1
Sequence:CCGGTAATACCCAACTGAGTGATTTCTCGAGAAATCACTCAGTTGGGTATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-956s21c1
Sequence:CCGGGTCCAGCCAGACTTCGGATAACTCGAGTTATCCGAAGTCTGGCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-1081s21c1
Sequence:CCGGTCTGCAGCGGACTAGACTATTCTCGAGAATAGTCTAGTCCGCTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-1203s21c1
Sequence:CCGGCCCATCGTGGTAGCCATTAATCTCGAGATTAATGGCTACCACGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029441.2-305s21c1
Sequence:CCGGCCTGCACTGTGAGGAGTTTATCTCGAGATAAACTCCTCACAGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029441.1-741s1c1
Sequence:CCGGGAATGAAAGCAACTGTCGGTTCTCGAGAACCGACAGTTGCTTTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)