EMAIL THIS PAGE TO A FRIEND

CDYL

chromodomain protein, Y-like

198 Gene Product Result for
Synonyms: CDYL1
Gene ID:
Human(9425) Summary: Chromodomain Y is a primate-specific Y-chromosomal gene family expressed exclusively in the testis and implicated in infertility. Although the Y-linked genes are testis-specific, this autosomal gene is ubiquitously expressed. The Y-linked genes arose by retrotransposition of an mRNA from this gene, followed by amplification of the retroposed gene. Proteins encoded by this gene superfamily possess a chromodomain, a motif implicated in chromatin binding and gene suppression, and a catalytic domain believed to be involved in histone acetylation. Multiple proteins are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Mouse(12593) chromodomain protein, Y chromosome-like
Rat(361237) chromodomain protein, Y-like
Zebrafish(568457) chromodomain protein, Y-like
dog(478708) chromodomain protein, Y-like
cow(539013) chromodomain protein, Y-like
Horse(100060026) chromodomain protein, Y-like
domestic cat(101082311) chromodomain protein, Y-like
chicken(420877) chromodomain protein, Y-like
sheep(101120964) chromodomain protein, Y-like
domestic guinea pig(100718582) chromodomain protein, Y-like
naked mole-rat(101721111) chromodomain protein, Y-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004824 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004824 Rosetta Predictions human pricing
NM_170751 Rosetta Predictions human pricing
NM_170752 Rosetta Predictions human pricing
NM_001014145 Rosetta Predictions rat pricing
NM_001123386 Rosetta Predictions mouse pricing
NM_009881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247354 predicted 1546
2 SASI_Hs01_00247356 predicted 1212
3 SASI_Hs01_00247357 predicted 1489
4 SASI_Hs01_00247358 predicted 1203
5 SASI_Hs01_00247359 predicted 1724
6 SASI_Hs01_00247360 predicted 1224
7 SASI_Hs02_00338390 predicted 1443
8 SASI_Hs01_00247361 predicted 1246
9 SASI_Hs01_00247362 predicted 1406
10 SASI_Hs02_00338391 predicted 1436
11 SASI_Hs01_00247355 predicted 1447
12 SASI_Hs01_00247363 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064221 predicted 1593
2 SASI_Hs01_00064223 predicted 1255
3 SASI_Hs01_00064224 predicted 1530
4 SASI_Hs01_00064225 predicted 1247
5 SASI_Hs01_00064226 predicted 1758
6 SASI_Hs01_00064227 predicted 1258
7 SASI_Hs02_00367717 predicted 1482
8 SASI_Hs01_00064228 predicted 1281
9 SASI_Hs01_00064229 predicted 1447
10 SASI_Hs02_00367718 predicted 1476
11 SASI_Hs01_00064222 predicted 1490
12 SASI_Hs01_00064230 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225035 predicted 925
2 SASI_Hs01_00225037 predicted 582
3 SASI_Hs01_00225038 predicted 857
4 SASI_Hs01_00225039 predicted 573
5 SASI_Hs01_00225040 predicted 1098
6 SASI_Hs01_00225041 predicted 596
7 SASI_Hs02_00367719 predicted 822
8 SASI_Hs01_00225042 predicted 615
9 SASI_Hs01_00225043 predicted 785
10 SASI_Hs02_00367720 predicted 806
11 SASI_Hs01_00225036 predicted 828
12 SASI_Hs01_00225044 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111479 predicted 1434
2 SASI_Rn01_00111481 predicted 1515
3 SASI_Rn01_00111482 predicted 1556
4 SASI_Rn01_00111483 predicted 1529
5 SASI_Rn01_00111484 predicted 435
6 SASI_Rn02_00201605 predicted 1134
7 SASI_Rn01_00111486 predicted 1615
8 SASI_Rn01_00111488 predicted 1168
9 SASI_Rn02_00201606 predicted 1547
10 SASI_Rn02_00201607 predicted 425
11 SASI_Rn01_00111480 predicted 1873
12 SASI_Rn01_00111485 predicted 1319
13 SASI_Rn01_00111487 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309875 predicted 1568
2 SASI_Mm02_00309876 predicted 1619
3 SASI_Mm02_00309877 predicted 1586
4 SASI_Mm02_00309878 predicted 1239
5 SASI_Mm02_00309879 predicted 1609
6 SASI_Mm02_00309880 predicted 2122
7 SASI_Mm02_00309881 predicted 1759
8 SASI_Mm02_00309882 predicted 1569
9 SASI_Mm02_00309883 predicted 1580
10 SASI_Mm02_00309884 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317355 predicted 1526
2 SASI_Mm02_00317356 predicted 1562
3 SASI_Mm02_00317357 predicted 1533
4 SASI_Mm02_00317358 predicted 1181
5 SASI_Mm02_00317359 predicted 1565
6 SASI_Mm01_00102818 predicted 2080
7 SASI_Mm02_00317360 predicted 1703
8 SASI_Mm02_00317361 predicted 1520
9 SASI_Mm02_00317362 predicted 1523
10 SASI_Mm02_00317363 predicted 1574
11 SASI_Mm01_00102815 predicted 1656
12 SASI_Mm01_00102816 predicted 1697
13 SASI_Mm01_00102817 predicted 318
14 SASI_Mm01_00102819 predicted 1927
15 SASI_Mm01_00102820 predicted 331
16 SASI_Mm01_00102821 predicted 262
17 SASI_Mm01_00102822 predicted 1601
18 SASI_Mm01_00102823 predicted 679
19 SASI_Mm01_00102824 predicted 2025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004824
VALIDATED
CDYL MISSION shRNA Bacterial Glycerol Stock
chromodomain protein, Y-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004824.2-1448s1c1
Sequence:CCGGGCCCATTATTGTAGCAGTCAACTCGAGTTGACTGCTACAATAATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004824.2-2529s1c1
Sequence:CCGGGCTTAGGATTCATGCTGAGATCTCGAGATCTCAGCATGAATCCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004824.2-307s1c1
Sequence:CCGGCCGCTTTACAGGTTGAAAGGACTCGAGTCCTTTCAACCTGTAAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004824.2-695s1c1
Sequence:CCGGCCTAGCGAAGTCAGGTATCAACTCGAGTTGATACCTGACTTCGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004824.2-2762s1c1
Sequence:CCGGGCTGGGTGAGAAATACTACTTCTCGAGAAGTAGTATTTCTCACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004824.3-1453s21c1
Sequence:GTACCGGCTATCAGAAACTTCGTGAATACTCGAGTATTCACGAAGTTTCTGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004824.3-1623s21c1
Sequence:GTACCGGGATGGCTGTTCTACCGTTATGCTCGAGCATAACGGTAGAACAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-2529s21c1
Sequence:CCGGGCTTAGGATTCATGCTGAGATCTCGAGATCTCAGCATGAATCCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-1725s21c1
Sequence:CCGGGAAGTGATGGTTCGCATTAAGCTCGAGCTTAATGCGAACCATCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-695s21c1
Sequence:CCGGCCTAGCGAAGTCAGGTATCAACTCGAGTTGATACCTGACTTCGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-1448s21c1
Sequence:CCGGGCCCATTATTGTAGCAGTCAACTCGAGTTGACTGCTACAATAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004824.3-1555s21c1
Sequence:GTACCGGGCGATGTGGTTTGGGCTAATGCTCGAGCATTAGCCCAAACCACATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004824
VALIDATED
CDYL MISSION shRNA shRNA Plasmid DNA
chromodomain protein, Y-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004824.2-1448s1c1
Sequence:CCGGGCCCATTATTGTAGCAGTCAACTCGAGTTGACTGCTACAATAATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004824.2-2529s1c1
Sequence:CCGGGCTTAGGATTCATGCTGAGATCTCGAGATCTCAGCATGAATCCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004824.2-307s1c1
Sequence:CCGGCCGCTTTACAGGTTGAAAGGACTCGAGTCCTTTCAACCTGTAAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004824.2-695s1c1
Sequence:CCGGCCTAGCGAAGTCAGGTATCAACTCGAGTTGATACCTGACTTCGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004824.2-2762s1c1
Sequence:CCGGGCTGGGTGAGAAATACTACTTCTCGAGAAGTAGTATTTCTCACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004824.3-1453s21c1
Sequence:GTACCGGCTATCAGAAACTTCGTGAATACTCGAGTATTCACGAAGTTTCTGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004824.3-1623s21c1
Sequence:GTACCGGGATGGCTGTTCTACCGTTATGCTCGAGCATAACGGTAGAACAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-2529s21c1
Sequence:CCGGGCTTAGGATTCATGCTGAGATCTCGAGATCTCAGCATGAATCCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-1725s21c1
Sequence:CCGGGAAGTGATGGTTCGCATTAAGCTCGAGCTTAATGCGAACCATCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-695s21c1
Sequence:CCGGCCTAGCGAAGTCAGGTATCAACTCGAGTTGATACCTGACTTCGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-1448s21c1
Sequence:CCGGGCCCATTATTGTAGCAGTCAACTCGAGTTGACTGCTACAATAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004824.3-1555s21c1
Sequence:GTACCGGGCGATGTGGTTTGGGCTAATGCTCGAGCATTAGCCCAAACCACATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004824
VALIDATED
CDYL MISSION shRNA Lentiviral Transduction Particles
chromodomain protein, Y-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004824.2-1448s1c1
Sequence:CCGGGCCCATTATTGTAGCAGTCAACTCGAGTTGACTGCTACAATAATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004824.2-2529s1c1
Sequence:CCGGGCTTAGGATTCATGCTGAGATCTCGAGATCTCAGCATGAATCCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004824.2-307s1c1
Sequence:CCGGCCGCTTTACAGGTTGAAAGGACTCGAGTCCTTTCAACCTGTAAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004824.2-695s1c1
Sequence:CCGGCCTAGCGAAGTCAGGTATCAACTCGAGTTGATACCTGACTTCGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004824.2-2762s1c1
Sequence:CCGGGCTGGGTGAGAAATACTACTTCTCGAGAAGTAGTATTTCTCACCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004824.3-1453s21c1
Sequence:GTACCGGCTATCAGAAACTTCGTGAATACTCGAGTATTCACGAAGTTTCTGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004824.3-1623s21c1
Sequence:GTACCGGGATGGCTGTTCTACCGTTATGCTCGAGCATAACGGTAGAACAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-2529s21c1
Sequence:CCGGGCTTAGGATTCATGCTGAGATCTCGAGATCTCAGCATGAATCCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-1725s21c1
Sequence:CCGGGAAGTGATGGTTCGCATTAAGCTCGAGCTTAATGCGAACCATCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-695s21c1
Sequence:CCGGCCTAGCGAAGTCAGGTATCAACTCGAGTTGATACCTGACTTCGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004824.2-1448s21c1
Sequence:CCGGGCCCATTATTGTAGCAGTCAACTCGAGTTGACTGCTACAATAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004824.3-1555s21c1
Sequence:GTACCGGGCGATGTGGTTTGGGCTAATGCTCGAGCATTAGCCCAAACCACATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009881
VALIDATED
CDYL MISSION shRNA Bacterial Glycerol Stock
chromodomain protein, Y-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1315s1c1
Sequence:CCGGCGTCAGAGAATAACTCACTAACTCGAGTTAGTGAGTTATTCTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1638s1c1
Sequence:CCGGGCTTGGTTTCAAACACCCTATCTCGAGATAGGGTGTTTGAAACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1523s1c1
Sequence:CCGGCGTGAATACTTTCATTCAGTTCTCGAGAACTGAATGAAAGTATTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1693s1c1
Sequence:CCGGCCGTTATGTTTCCCAAGATTACTCGAGTAATCTTGGGAAACATAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-2714s1c1
Sequence:CCGGCGAGTGTTACTTGCTAAGTTACTCGAGTAACTTAGCAAGTAACACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009881.3-2125s21c1
Sequence:CCGGTGGAAACATCCGAGCTATTTACTCGAGTAAATAGCTCGGATGTTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009881.3-332s21c1
Sequence:CCGGTGAACAACCTACTGATGATAACTCGAGTTATCATCAGTAGGTTGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009881.3-1656s21c1
Sequence:CCGGGCTTGGTTTCAAACACCCTATCTCGAGATAGGGTGTTTGAAACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009881.3-1333s21c1
Sequence:CCGGCGTCAGAGAATAACTCACTAACTCGAGTTAGTGAGTTATTCTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009881.3-1541s21c1
Sequence:CCGGCGTGAATACTTTCATTCAGTTCTCGAGAACTGAATGAAAGTATTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009881
VALIDATED
CDYL MISSION shRNA shRNA Plasmid DNA
chromodomain protein, Y-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1315s1c1
Sequence:CCGGCGTCAGAGAATAACTCACTAACTCGAGTTAGTGAGTTATTCTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1638s1c1
Sequence:CCGGGCTTGGTTTCAAACACCCTATCTCGAGATAGGGTGTTTGAAACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1523s1c1
Sequence:CCGGCGTGAATACTTTCATTCAGTTCTCGAGAACTGAATGAAAGTATTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1693s1c1
Sequence:CCGGCCGTTATGTTTCCCAAGATTACTCGAGTAATCTTGGGAAACATAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-2714s1c1
Sequence:CCGGCGAGTGTTACTTGCTAAGTTACTCGAGTAACTTAGCAAGTAACACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009881.3-2125s21c1
Sequence:CCGGTGGAAACATCCGAGCTATTTACTCGAGTAAATAGCTCGGATGTTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009881.3-332s21c1
Sequence:CCGGTGAACAACCTACTGATGATAACTCGAGTTATCATCAGTAGGTTGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009881.3-1656s21c1
Sequence:CCGGGCTTGGTTTCAAACACCCTATCTCGAGATAGGGTGTTTGAAACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009881.3-1333s21c1
Sequence:CCGGCGTCAGAGAATAACTCACTAACTCGAGTTAGTGAGTTATTCTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009881.3-1541s21c1
Sequence:CCGGCGTGAATACTTTCATTCAGTTCTCGAGAACTGAATGAAAGTATTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009881
VALIDATED
CDYL MISSION shRNA Lentiviral Transduction Particles
chromodomain protein, Y-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1315s1c1
Sequence:CCGGCGTCAGAGAATAACTCACTAACTCGAGTTAGTGAGTTATTCTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1638s1c1
Sequence:CCGGGCTTGGTTTCAAACACCCTATCTCGAGATAGGGTGTTTGAAACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1523s1c1
Sequence:CCGGCGTGAATACTTTCATTCAGTTCTCGAGAACTGAATGAAAGTATTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-1693s1c1
Sequence:CCGGCCGTTATGTTTCCCAAGATTACTCGAGTAATCTTGGGAAACATAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009881.1-2714s1c1
Sequence:CCGGCGAGTGTTACTTGCTAAGTTACTCGAGTAACTTAGCAAGTAACACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009881.3-2125s21c1
Sequence:CCGGTGGAAACATCCGAGCTATTTACTCGAGTAAATAGCTCGGATGTTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009881.3-332s21c1
Sequence:CCGGTGAACAACCTACTGATGATAACTCGAGTTATCATCAGTAGGTTGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009881.3-1656s21c1
Sequence:CCGGGCTTGGTTTCAAACACCCTATCTCGAGATAGGGTGTTTGAAACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009881.3-1333s21c1
Sequence:CCGGCGTCAGAGAATAACTCACTAACTCGAGTTAGTGAGTTATTCTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009881.3-1541s21c1
Sequence:CCGGCGTGAATACTTTCATTCAGTTCTCGAGAACTGAATGAAAGTATTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)