EMAIL THIS PAGE TO A FRIEND

CEACAM16

carcinoembryonic antigen-related cell adhesion molecule 16

72 Gene Product Result for
Synonyms: CEAL2 DFNA4B
UniProtKB ID: Q2WEN9, A7LI12
Gene ID:
Human(388551) Summary: The protein encoded by this gene is a secreted glycoprotein that in mouse interacts with tectorial membrane proteins in the inner ear. The encoded adhesion protein is found in cochlear outer hair cells and appears to be important for proper hearing over an extended frequency range. Defects in this gene likely are a cause of non-syndromic autosomal dominant hearing loss. [provided by RefSeq, May 2012]
Mouse(330483) carcinoembryonic antigen-related cell adhesion molecule 16
Rat(292700) carcinoembryonic antigen-related cell adhesion molecule 16
domestic guinea pig(100718007) carcinoembryonic antigen-related cell adhesion molecule 16
naked mole-rat(101712514) carcinoembryonic antigen-related cell adhesion molecule 16
sheep(101110784) carcinoembryonic antigen-related cell adhesion molecule 16
domestic cat(101096274) carcinoembryonic antigen-related cell adhesion molecule 16
cow(100848915) carcinoembryonic antigen-related cell adhesion molecule 16
Horse(100070583) carcinoembryonic antigen-related cell adhesion molecule 16
dog(484457) carcinoembryonic antigen-related cell adhesion molecule 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100393 Anti-CEACAM16 (ab1) antibody produced in rabbit affinity isolated antibody horse, rat, human, guinea pig, canine, mouse, rabbit
western blot pricing
SAB2100394 Anti-CEACAM16 (ab2) antibody produced in rabbit affinity isolated antibody rat, guinea pig, rabbit, human, canine, mouse, horse
western blot pricing
HPA045075 Anti-CEACAM16 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039213 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU163071 MISSION® esiRNA esiRNA targeting mouse Ceacam16 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039213 Rosetta Predictions human pricing
XM_001076153 Rosetta Predictions rat pricing
XM_214856 Rosetta Predictions rat pricing
NM_001033419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208810 predicted 1179
2 SASI_Hs01_00208811 predicted 897
3 SASI_Hs01_00208812 predicted 670
4 SASI_Hs01_00208813 predicted 1202
5 SASI_Hs01_00208814 predicted 1537
6 SASI_Hs01_00208815 predicted 1238
7 SASI_Hs01_00208816 predicted 1097
8 SASI_Hs01_00208817 predicted 950
9 SASI_Hs01_00208818 predicted 1309
10 SASI_Hs01_00208819 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352251 predicted 463
2 SASI_Rn02_00352252 predicted 707
3 SASI_Rn02_00352253 predicted 1239
4 SASI_Rn02_00352254 predicted 1227
5 SASI_Rn02_00352255 predicted 1480
6 SASI_Rn02_00352256 predicted 253
7 SASI_Rn02_00352257 predicted 391
8 SASI_Rn02_00352258 predicted 1061
9 SASI_Rn02_00352259 predicted 607
10 SASI_Rn02_00352260 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375637 predicted 1473
2 SASI_Rn02_00375638 predicted 253
3 SASI_Rn02_00375639 predicted 388
4 SASI_Rn02_00375640 predicted 415
5 SASI_Rn02_00375641 predicted 412
6 SASI_Rn02_00375642 predicted 1470
7 SASI_Rn02_00375643 predicted 247
8 SASI_Rn02_00375644 predicted 445
9 SASI_Rn02_00375645 predicted 1486
10 SASI_Rn02_00375646 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117062 predicted 789
2 SASI_Mm02_00288718 predicted 941
3 SASI_Mm01_00117063 predicted 1104
4 SASI_Mm01_00117064 predicted 587
5 SASI_Mm01_00117065 predicted 973
6 SASI_Mm01_00117066 predicted 481
7 SASI_Mm01_00117067 predicted 1177
8 SASI_Mm02_00288719 predicted 584
9 SASI_Mm01_00117068 predicted 924
10 SASI_Mm02_00288720 predicted 1355
11 SASI_Mm01_00117061 predicted 881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033419
CEACAM16 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-790s21c1
Sequence:CCGGGCCACTGAACTTGACGGTATACTCGAGTATACCGTCAAGTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-854s21c1
Sequence:CCGGCGCACGGGCTGCACTATTAAACTCGAGTTTAATAGTGCAGCCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-1112s21c1
Sequence:CCGGATCGTTCCTGTACCGACTAAGCTCGAGCTTAGTCGGTACAGGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-291s21c1
Sequence:CCGGGGGAACTGCTTGCCTACAATTCTCGAGAATTGTAGGCAAGCAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-1176s21c1
Sequence:CCGGCCAAGGACCTGCTAGTCTATGCTCGAGCATAGACTAGCAGGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033419
CEACAM16 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-790s21c1
Sequence:CCGGGCCACTGAACTTGACGGTATACTCGAGTATACCGTCAAGTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-854s21c1
Sequence:CCGGCGCACGGGCTGCACTATTAAACTCGAGTTTAATAGTGCAGCCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-1112s21c1
Sequence:CCGGATCGTTCCTGTACCGACTAAGCTCGAGCTTAGTCGGTACAGGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-291s21c1
Sequence:CCGGGGGAACTGCTTGCCTACAATTCTCGAGAATTGTAGGCAAGCAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-1176s21c1
Sequence:CCGGCCAAGGACCTGCTAGTCTATGCTCGAGCATAGACTAGCAGGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033419
CEACAM16 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-790s21c1
Sequence:CCGGGCCACTGAACTTGACGGTATACTCGAGTATACCGTCAAGTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-854s21c1
Sequence:CCGGCGCACGGGCTGCACTATTAAACTCGAGTTTAATAGTGCAGCCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-1112s21c1
Sequence:CCGGATCGTTCCTGTACCGACTAAGCTCGAGCTTAGTCGGTACAGGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-291s21c1
Sequence:CCGGGGGAACTGCTTGCCTACAATTCTCGAGAATTGTAGGCAAGCAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033419.2-1176s21c1
Sequence:CCGGCCAAGGACCTGCTAGTCTATGCTCGAGCATAGACTAGCAGGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039213
CEACAM16 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-182s21c1
Sequence:CCGGTGTACTTCACATGTTACAAATCTCGAGATTTGTAACATGTGAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-252s21c1
Sequence:CCGGGTAGGAAACAGTGGAACTATGCTCGAGCATAGTTCCACTGTTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039213.1-1608s21c1
Sequence:CCGGGTCCAGAGAGAAGAGCTCTTCCTCGAGGAAGAGCTCTTCTCTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-955s21c1
Sequence:CCGGTCAACCTGACCGTGTACTTTGCTCGAGCAAAGTACACGGTCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-214s21c1
Sequence:CCGGGGCTTGGCAGAGTCCATAAATCTCGAGATTTATGGACTCTGCCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039213
CEACAM16 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-182s21c1
Sequence:CCGGTGTACTTCACATGTTACAAATCTCGAGATTTGTAACATGTGAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-252s21c1
Sequence:CCGGGTAGGAAACAGTGGAACTATGCTCGAGCATAGTTCCACTGTTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039213.1-1608s21c1
Sequence:CCGGGTCCAGAGAGAAGAGCTCTTCCTCGAGGAAGAGCTCTTCTCTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-955s21c1
Sequence:CCGGTCAACCTGACCGTGTACTTTGCTCGAGCAAAGTACACGGTCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-214s21c1
Sequence:CCGGGGCTTGGCAGAGTCCATAAATCTCGAGATTTATGGACTCTGCCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039213
CEACAM16 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-182s21c1
Sequence:CCGGTGTACTTCACATGTTACAAATCTCGAGATTTGTAACATGTGAAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-252s21c1
Sequence:CCGGGTAGGAAACAGTGGAACTATGCTCGAGCATAGTTCCACTGTTTCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039213.1-1608s21c1
Sequence:CCGGGTCCAGAGAGAAGAGCTCTTCCTCGAGGAAGAGCTCTTCTCTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-955s21c1
Sequence:CCGGTCAACCTGACCGTGTACTTTGCTCGAGCAAAGTACACGGTCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039213.1-214s21c1
Sequence:CCGGGGCTTGGCAGAGTCCATAAATCTCGAGATTTATGGACTCTGCCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks