EMAIL THIS PAGE TO A FRIEND

CEACAM18

carcinoembryonic antigen-related cell adhesion molecule 18

47 Gene Product Result for
UniProtKB ID: A8MTB9, C9JN24
Gene ID:
Mouse(72431) carcinoembryonic antigen-related cell adhesion molecule 18
Rat(502334) carcinoembryonic antigen-related cell adhesion molecule 18
dog(484346) carcinoembryonic antigen-related cell adhesion molecule 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301793 ANTI-CEACAM18 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080405 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU021251 MISSION® esiRNA esiRNA targeting mouse Ceacam18 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080405 Rosetta Predictions human pricing
XM_001080380 Rosetta Predictions rat pricing
XM_577799 Rosetta Predictions rat pricing
NM_028236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314528 predicted 940
2 SASI_Hs02_00314529 predicted 927
3 SASI_Hs02_00314530 predicted 882
4 SASI_Hs02_00314531 predicted 387
5 SASI_Hs02_00314532 predicted 792
6 SASI_Hs02_00314533 predicted 796
7 SASI_Hs02_00314534 predicted 951
8 SASI_Hs02_00314535 predicted 778
9 SASI_Hs02_00314536 predicted 819
10 SASI_Hs02_00314537 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367800 predicted 258
2 SASI_Rn02_00367801 predicted 453
3 SASI_Rn02_00367802 predicted 196
4 SASI_Rn02_00367803 predicted 667
5 SASI_Rn02_00367804 predicted 683
6 SASI_Rn02_00367805 predicted 535
7 SASI_Rn02_00367806 predicted 772
8 SASI_Rn02_00367807 predicted 420
9 SASI_Rn02_00367808 predicted 561
10 SASI_Rn02_00367809 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407078 predicted 519
2 SASI_Rn02_00407079 predicted 203
3 SASI_Rn02_00407080 predicted 724
4 SASI_Rn02_00407081 predicted 376
5 SASI_Rn02_00407082 predicted 748
6 SASI_Rn02_00407083 predicted 602
7 SASI_Rn02_00407084 predicted 831
8 SASI_Rn02_00407085 predicted 484
9 SASI_Rn02_00407086 predicted 627
10 SASI_Rn02_00407087 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138680 predicted 789
2 SASI_Mm01_00138681 predicted 1024
3 SASI_Mm01_00138682 predicted 637
4 SASI_Mm01_00138684 predicted 615
5 SASI_Mm01_00138685 predicted 827
6 SASI_Mm01_00138686 predicted 342
7 SASI_Mm01_00138687 predicted 353
8 SASI_Mm01_00138688 predicted 590
9 SASI_Mm01_00138689 predicted 244
10 SASI_Mm02_00333585 predicted 538
11 SASI_Mm01_00138683 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080405
CEACAM18 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-486s21c1
Sequence:CCGGGATCAGGCCGACTGCATTAAACTCGAGTTTAATGCAGTCGGCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-769s21c1
Sequence:CCGGAGCCGCTATGACAGAACAATTCTCGAGAATTGTTCTGTCATAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-385s21c1
Sequence:CCGGAGCGCAGGAAACATGATTATCCTCGAGGATAATCATGTTTCCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-596s21c1
Sequence:CCGGATCTGGGCATCTCCGTCAATGCTCGAGCATTGACGGAGATGCCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-712s21c1
Sequence:CCGGAGTAGTGACCGGATGACAATTCTCGAGAATTGTCATCCGGTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080405
CEACAM18 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-486s21c1
Sequence:CCGGGATCAGGCCGACTGCATTAAACTCGAGTTTAATGCAGTCGGCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-769s21c1
Sequence:CCGGAGCCGCTATGACAGAACAATTCTCGAGAATTGTTCTGTCATAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-385s21c1
Sequence:CCGGAGCGCAGGAAACATGATTATCCTCGAGGATAATCATGTTTCCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-596s21c1
Sequence:CCGGATCTGGGCATCTCCGTCAATGCTCGAGCATTGACGGAGATGCCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-712s21c1
Sequence:CCGGAGTAGTGACCGGATGACAATTCTCGAGAATTGTCATCCGGTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080405
CEACAM18 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-486s21c1
Sequence:CCGGGATCAGGCCGACTGCATTAAACTCGAGTTTAATGCAGTCGGCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-769s21c1
Sequence:CCGGAGCCGCTATGACAGAACAATTCTCGAGAATTGTTCTGTCATAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-385s21c1
Sequence:CCGGAGCGCAGGAAACATGATTATCCTCGAGGATAATCATGTTTCCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-596s21c1
Sequence:CCGGATCTGGGCATCTCCGTCAATGCTCGAGCATTGACGGAGATGCCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080405.1-712s21c1
Sequence:CCGGAGTAGTGACCGGATGACAATTCTCGAGAATTGTCATCCGGTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028236
CEACAM18 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028236.1-1800s1c1
Sequence:CCGGGCAGCTCACAATCACCTGTAACTCGAGTTACAGGTGATTGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-644s1c1
Sequence:CCGGGCCATAGAAGATGTGCCAGAACTCGAGTTCTGGCACATCTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-424s1c1
Sequence:CCGGGATCGTAAAGTTGAGAAGCAACTCGAGTTGCTTCTCAACTTTACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-222s1c1
Sequence:CCGGGCAAGGACAACAGTACAGAAACTCGAGTTTCTGTACTGTTGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-1019s1c1
Sequence:CCGGCCAGGACCCTTGGTGATATTTCTCGAGAAATATCACCAAGGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028236
CEACAM18 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028236.1-1800s1c1
Sequence:CCGGGCAGCTCACAATCACCTGTAACTCGAGTTACAGGTGATTGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-644s1c1
Sequence:CCGGGCCATAGAAGATGTGCCAGAACTCGAGTTCTGGCACATCTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-424s1c1
Sequence:CCGGGATCGTAAAGTTGAGAAGCAACTCGAGTTGCTTCTCAACTTTACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-222s1c1
Sequence:CCGGGCAAGGACAACAGTACAGAAACTCGAGTTTCTGTACTGTTGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-1019s1c1
Sequence:CCGGCCAGGACCCTTGGTGATATTTCTCGAGAAATATCACCAAGGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028236
CEACAM18 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028236.1-1800s1c1
Sequence:CCGGGCAGCTCACAATCACCTGTAACTCGAGTTACAGGTGATTGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-644s1c1
Sequence:CCGGGCCATAGAAGATGTGCCAGAACTCGAGTTCTGGCACATCTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-424s1c1
Sequence:CCGGGATCGTAAAGTTGAGAAGCAACTCGAGTTGCTTCTCAACTTTACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-222s1c1
Sequence:CCGGGCAAGGACAACAGTACAGAAACTCGAGTTTCTGTACTGTTGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028236.1-1019s1c1
Sequence:CCGGCCAGGACCCTTGGTGATATTTCTCGAGAAATATCACCAAGGGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks