EMAIL THIS PAGE TO A FRIEND

CEACAM19

carcinoembryonic antigen-related cell adhesion molecule 19

64 Gene Product Result for
Synonyms: CEAL1
UniProtKB ID: Q7Z692, Q5XJ15, Q7Z693
Gene ID:
Mouse(319930) carcinoembryonic antigen-related cell adhesion molecule 19
Rat(680640) carcinoembryonic antigen-related cell adhesion molecule 19
domestic guinea pig(100717723) carcinoembryonic antigen-related cell adhesion molecule 19
naked mole-rat(101705557) carcinoembryonic antigen-related cell adhesion molecule 19
sheep(101111222) carcinoembryonic antigen-related cell adhesion molecule 19
cow(511941) carcinoembryonic antigen-related cell adhesion molecule 19
domestic cat(101096523) carcinoembryonic antigen-related cell adhesion molecule 19
dog(100687409) carcinoembryonic antigen-related cell adhesion molecule 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020219 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177036 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177036 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177036 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122291 MISSION® esiRNA esiRNA human CEACAM19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127893 Rosetta Predictions human pricing
NM_020219 Rosetta Predictions human pricing
XM_001058105 Rosetta Predictions rat pricing
NM_177036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330424 predicted 589
2 SASI_Hs02_00330425 predicted 570
3 SASI_Hs02_00330426 predicted 1746
4 SASI_Hs02_00330427 predicted 1733
5 SASI_Hs02_00330428 predicted 1732
6 SASI_Hs02_00330429 predicted 719
7 SASI_Hs02_00330430 predicted 1784
8 SASI_Hs02_00330431 predicted 628
9 SASI_Hs02_00330432 predicted 753
10 SASI_Hs02_00330433 predicted 1744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149187 predicted 322
2 SASI_Hs01_00149188 predicted 304
3 SASI_Hs01_00149190 predicted 1483
4 SASI_Hs01_00149191 predicted 1464
5 SASI_Hs01_00149192 predicted 1459
6 SASI_Hs01_00149193 predicted 456
7 SASI_Hs01_00149195 predicted 1512
8 SASI_Hs01_00149196 predicted 362
9 SASI_Hs02_00353162 predicted 475
10 SASI_Hs02_00353163 predicted 1476
11 SASI_Hs01_00149189 predicted 305
12 SASI_Hs01_00149194 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288614 predicted 481
2 SASI_Rn02_00288615 predicted 224
3 SASI_Rn02_00288616 predicted 213
4 SASI_Rn02_00288617 predicted 473
5 SASI_Rn02_00288618 predicted 595
6 SASI_Rn02_00288619 predicted 211
7 SASI_Rn02_00288620 predicted 290
8 SASI_Rn02_00288621 predicted 273
9 SASI_Rn02_00288622 predicted 316
10 SASI_Rn02_00288623 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043034 predicted 905
2 SASI_Mm01_00043035 predicted 906
3 SASI_Mm01_00043036 predicted 637
4 SASI_Mm01_00043037 predicted 470
5 SASI_Mm01_00043038 predicted 631
6 SASI_Mm01_00043039 predicted 836
7 SASI_Mm01_00043040 predicted 544
8 SASI_Mm01_00043041 predicted 678
9 SASI_Mm01_00043042 predicted 498
10 SASI_Mm01_00043043 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020219
VALIDATED
CEACAM19 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 19
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020219.2-1330s1c1
Sequence:CCGGGCCTTCGGTCTGTTCCTTCAACTCGAGTTGAAGGAACAGACCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-913s1c1
Sequence:CCGGGCTGGTGACAACAACATCTATCTCGAGATAGATGTTGTTGTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-691s1c1
Sequence:CCGGGCCACCATCATTGGATCTCTTCTCGAGAAGAGATCCAATGATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-432s1c1
Sequence:CCGGCACGAGGCTATTTACCTACATCTCGAGATGTAGGTAAATAGCCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020219.2-905s1c1
Sequence:CCGGCTCATGATGCTGGTGACAACACTCGAGTGTTGTCACCAGCATCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-969s1c1
Sequence:CCGGCATCAGTGACACAAGGTCCATCTCGAGATGGACCTTGTGTCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020219.2-315s1c1
Sequence:CCGGCATCCAGAAGATTCCAGAGCACTCGAGTGCTCTGGAATCTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-563s1c1
Sequence:CCGGGCACCTACCAAGTAGCCATTACTCGAGTAATGGCTACTTGGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020219.2-600s1c1
Sequence:CCGGGACTATGAAGGCCAAGACTGACTCGAGTCAGTCTTGGCCTTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-912s21c1
Sequence:CCGGTAAGGAGCTGCCCAGTACACACTCGAGTGTGTACTGGGCAGCTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-1320s21c1
Sequence:CCGGGTACCAGCAGGACCTGCTAAACTCGAGTTTAGCAGGTCCTGCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-1242s21c1
Sequence:CCGGCAGTGACACAAGGTCCATAAACTCGAGTTTATGGACCTTGTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020219.3-1791s21c1
Sequence:CCGGTAGTGACCCTCAGAGTCTTCTCTCGAGAGAAGACTCTGAGGGTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-834s21c1
Sequence:CCGGCACCTACCAAGTAGCCATTACCTCGAGGTAATGGCTACTTGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020219.3-1572s21c1
Sequence:CCGGTCCTTGTGCAGCCCGTGAATGCTCGAGCATTCACGGGCTGCACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-999s21c1
Sequence:CCGGCATCAGCTGCATTGCCTATCTCTCGAGAGATAGGCAATGCAGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-1088s21c1
Sequence:CCGGCCATCTTGTGCTCGGCTGTATCTCGAGATACAGCCGAGCACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-695s21c1
Sequence:CCGGACGGAGGCACGAGGCTATTTACTCGAGTAAATAGCCTCGTGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020219
VALIDATED
CEACAM19 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 19
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020219.2-1330s1c1
Sequence:CCGGGCCTTCGGTCTGTTCCTTCAACTCGAGTTGAAGGAACAGACCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-913s1c1
Sequence:CCGGGCTGGTGACAACAACATCTATCTCGAGATAGATGTTGTTGTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-691s1c1
Sequence:CCGGGCCACCATCATTGGATCTCTTCTCGAGAAGAGATCCAATGATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-432s1c1
Sequence:CCGGCACGAGGCTATTTACCTACATCTCGAGATGTAGGTAAATAGCCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020219.2-905s1c1
Sequence:CCGGCTCATGATGCTGGTGACAACACTCGAGTGTTGTCACCAGCATCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-969s1c1
Sequence:CCGGCATCAGTGACACAAGGTCCATCTCGAGATGGACCTTGTGTCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020219.2-315s1c1
Sequence:CCGGCATCCAGAAGATTCCAGAGCACTCGAGTGCTCTGGAATCTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-563s1c1
Sequence:CCGGGCACCTACCAAGTAGCCATTACTCGAGTAATGGCTACTTGGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020219.2-600s1c1
Sequence:CCGGGACTATGAAGGCCAAGACTGACTCGAGTCAGTCTTGGCCTTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-912s21c1
Sequence:CCGGTAAGGAGCTGCCCAGTACACACTCGAGTGTGTACTGGGCAGCTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-1320s21c1
Sequence:CCGGGTACCAGCAGGACCTGCTAAACTCGAGTTTAGCAGGTCCTGCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-1242s21c1
Sequence:CCGGCAGTGACACAAGGTCCATAAACTCGAGTTTATGGACCTTGTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020219.3-1791s21c1
Sequence:CCGGTAGTGACCCTCAGAGTCTTCTCTCGAGAGAAGACTCTGAGGGTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-834s21c1
Sequence:CCGGCACCTACCAAGTAGCCATTACCTCGAGGTAATGGCTACTTGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020219.3-1572s21c1
Sequence:CCGGTCCTTGTGCAGCCCGTGAATGCTCGAGCATTCACGGGCTGCACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-999s21c1
Sequence:CCGGCATCAGCTGCATTGCCTATCTCTCGAGAGATAGGCAATGCAGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-1088s21c1
Sequence:CCGGCCATCTTGTGCTCGGCTGTATCTCGAGATACAGCCGAGCACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-695s21c1
Sequence:CCGGACGGAGGCACGAGGCTATTTACTCGAGTAAATAGCCTCGTGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020219
VALIDATED
CEACAM19 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 19
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020219.2-1330s1c1
Sequence:CCGGGCCTTCGGTCTGTTCCTTCAACTCGAGTTGAAGGAACAGACCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-913s1c1
Sequence:CCGGGCTGGTGACAACAACATCTATCTCGAGATAGATGTTGTTGTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-691s1c1
Sequence:CCGGGCCACCATCATTGGATCTCTTCTCGAGAAGAGATCCAATGATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-432s1c1
Sequence:CCGGCACGAGGCTATTTACCTACATCTCGAGATGTAGGTAAATAGCCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020219.2-905s1c1
Sequence:CCGGCTCATGATGCTGGTGACAACACTCGAGTGTTGTCACCAGCATCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-969s1c1
Sequence:CCGGCATCAGTGACACAAGGTCCATCTCGAGATGGACCTTGTGTCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020219.2-315s1c1
Sequence:CCGGCATCCAGAAGATTCCAGAGCACTCGAGTGCTCTGGAATCTTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020219.2-563s1c1
Sequence:CCGGGCACCTACCAAGTAGCCATTACTCGAGTAATGGCTACTTGGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020219.2-600s1c1
Sequence:CCGGGACTATGAAGGCCAAGACTGACTCGAGTCAGTCTTGGCCTTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-912s21c1
Sequence:CCGGTAAGGAGCTGCCCAGTACACACTCGAGTGTGTACTGGGCAGCTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-1320s21c1
Sequence:CCGGGTACCAGCAGGACCTGCTAAACTCGAGTTTAGCAGGTCCTGCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-1242s21c1
Sequence:CCGGCAGTGACACAAGGTCCATAAACTCGAGTTTATGGACCTTGTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020219.3-1791s21c1
Sequence:CCGGTAGTGACCCTCAGAGTCTTCTCTCGAGAGAAGACTCTGAGGGTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-834s21c1
Sequence:CCGGCACCTACCAAGTAGCCATTACCTCGAGGTAATGGCTACTTGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020219.3-1572s21c1
Sequence:CCGGTCCTTGTGCAGCCCGTGAATGCTCGAGCATTCACGGGCTGCACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-999s21c1
Sequence:CCGGCATCAGCTGCATTGCCTATCTCTCGAGAGATAGGCAATGCAGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-1088s21c1
Sequence:CCGGCCATCTTGTGCTCGGCTGTATCTCGAGATACAGCCGAGCACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020219.3-695s21c1
Sequence:CCGGACGGAGGCACGAGGCTATTTACTCGAGTAAATAGCCTCGTGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177036
CEACAM19 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 19
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000175904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-558s1c1
Sequence:CCGGGCCAAGATTAACGTCCATGTACTCGAGTACATGGACGTTAATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-380s1c1
Sequence:CCGGCACAAGGCTGTTCTCTTATATCTCGAGATATAAGAGAACAGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-465s1c1
Sequence:CCGGCCAAATGGTTCCATGCTGCTTCTCGAGAAGCAGCATGGAACCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-750s1c1
Sequence:CCGGGAAGTGAACCTGAGTCCTGAACTCGAGTTCAGGACTCAGGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177036
CEACAM19 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 19
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000175904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-558s1c1
Sequence:CCGGGCCAAGATTAACGTCCATGTACTCGAGTACATGGACGTTAATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-380s1c1
Sequence:CCGGCACAAGGCTGTTCTCTTATATCTCGAGATATAAGAGAACAGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-465s1c1
Sequence:CCGGCCAAATGGTTCCATGCTGCTTCTCGAGAAGCAGCATGGAACCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-750s1c1
Sequence:CCGGGAAGTGAACCTGAGTCCTGAACTCGAGTTCAGGACTCAGGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177036
CEACAM19 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 19
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000175904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-558s1c1
Sequence:CCGGGCCAAGATTAACGTCCATGTACTCGAGTACATGGACGTTAATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-380s1c1
Sequence:CCGGCACAAGGCTGTTCTCTTATATCTCGAGATATAAGAGAACAGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-465s1c1
Sequence:CCGGCCAAATGGTTCCATGCTGCTTCTCGAGAAGCAGCATGGAACCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177036.2-750s1c1
Sequence:CCGGGAAGTGAACCTGAGTCCTGAACTCGAGTTCAGGACTCAGGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks