EMAIL THIS PAGE TO A FRIEND

CEACAM1

carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)

Synonyms: BGP BGP1 BGPI
Gene ID:
Human(634) Summary: This gene encodes a member of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily. Two subgroups of the CEA family, the CEA cell adhesion molecules and the pregnancy-specific glycoproteins, are located within a 1.2 Mb cluster on the long arm of chromosome 19. Eleven pseudogenes of the CEA cell adhesion molecule subgroup are also found in the cluster. The encoded protein was originally described in bile ducts of liver as biliary glycoprotein. Subsequently, it was found to be a cell-cell adhesion molecule detected on leukocytes, epithelia, and endothelia. The encoded protein mediates cell adhesion via homophilic as well as heterophilic binding to other proteins of the subgroup. Multiple cellular activities have been attributed to the encoded protein, including roles in the differentiation and arrangement of tissue three-dimensional structure, angiogenesis, apoptosis, tumor suppression, metastasis, and the modulation of innate and adaptive immune responses. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature of all variants has not been defined. [provided by RefSeq, May 2010]
Mouse(26365) carcinoembryonic antigen-related cell adhesion molecule 1
Rat(81613) carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
naked mole-rat(101708102) carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
domestic guinea pig(100730987) carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
sheep(101103343) carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
Zebrafish(114465) carcinoembryonic antigen-related cell adhesion molecule 1
dog(612435) carcinoembryonic antigen-related cell adhesion molecule 1
domestic cat(101086271) carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
cow(404118) carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001712 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024912 Rosetta Predictions human pricing
NM_001712 Rosetta Predictions human pricing
NM_001033860 Rosetta Predictions rat pricing
NM_001033861 Rosetta Predictions rat pricing
NM_001033862 Rosetta Predictions rat pricing
NM_031755 Rosetta Predictions rat pricing
NM_001039185 Rosetta Predictions mouse pricing
NM_001039186 Rosetta Predictions mouse pricing
NM_001039187 Rosetta Predictions mouse pricing
NM_011926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067405 predicted 908
2 SASI_Hs01_00067406 predicted 219
3 SASI_Hs01_00067407 predicted 911
4 SASI_Hs01_00067408 predicted 1123
5 SASI_Hs01_00067409 predicted 1157
6 SASI_Hs01_00067410 predicted 1054
7 SASI_Hs01_00067411 predicted 917
8 SASI_Hs01_00067412 predicted 1071
9 SASI_Hs01_00067413 predicted 1171
10 SASI_Hs01_00067414 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178825 predicted 1791
2 SASI_Hs01_00178826 predicted 908
3 SASI_Hs01_00178827 predicted 218
4 SASI_Hs01_00178828 predicted 908
5 SASI_Hs01_00178829 predicted 1124
6 SASI_Hs01_00178830 predicted 1155
7 SASI_Hs01_00178831 predicted 1055
8 SASI_Hs01_00178832 predicted 923
9 SASI_Hs01_00178833 predicted 1068
10 SASI_Hs01_00178834 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116153 predicted 410
2 SASI_Rn01_00116154 predicted 417
3 SASI_Rn01_00116155 predicted 731
4 SASI_Rn01_00116156 predicted 790
5 SASI_Rn02_00203760 predicted 678
6 SASI_Rn02_00203761 predicted 592
7 SASI_Rn01_00116157 predicted 991
8 SASI_Rn01_00116158 predicted 917
9 SASI_Rn01_00116159 predicted 939
10 SASI_Rn01_00116161 predicted 915
11 SASI_Rn01_00116160 predicted 568
12 SASI_Rn01_00116162 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075062 predicted 416
2 SASI_Rn01_00075063 predicted 423
3 SASI_Rn01_00075064 predicted 731
4 SASI_Rn01_00075065 predicted 788
5 SASI_Rn02_00203762 predicted 681
6 SASI_Rn02_00203763 predicted 590
7 SASI_Rn01_00075066 predicted 991
8 SASI_Rn01_00075067 predicted 917
9 SASI_Rn01_00075068 predicted 940
10 SASI_Rn01_00075070 predicted 909
11 SASI_Rn01_00075069 predicted 566
12 SASI_Rn01_00075071 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081455 predicted 414
2 SASI_Rn01_00081456 predicted 421
3 SASI_Rn01_00081457 predicted 738
4 SASI_Rn01_00081458 predicted 787
5 SASI_Rn02_00203764 predicted 677
6 SASI_Rn02_00203765 predicted 583
7 SASI_Rn01_00081459 predicted 985
8 SASI_Rn01_00081460 predicted 909
9 SASI_Rn01_00081461 predicted 936
10 SASI_Rn01_00081463 predicted 913
11 SASI_Rn01_00081462 predicted 570
12 SASI_Rn01_00081464 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116809 predicted 408
2 SASI_Rn01_00116810 predicted 419
3 SASI_Rn01_00116811 predicted 730
4 SASI_Rn01_00116812 predicted 783
5 SASI_Rn02_00265168 predicted 678
6 SASI_Rn02_00265169 predicted 586
7 SASI_Rn01_00116813 predicted 985
8 SASI_Rn01_00116814 predicted 910
9 SASI_Rn01_00116815 predicted 940
10 SASI_Rn01_00116817 predicted 912
11 SASI_Rn01_00116816 predicted 565
12 SASI_Rn01_00116818 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186718 predicted 327
2 SASI_Mm01_00186719 predicted 1260
3 SASI_Mm01_00186720 predicted 955
4 SASI_Mm01_00186721 predicted 298
5 SASI_Mm01_00186722 predicted 444
6 SASI_Mm01_00186723 predicted 820
7 SASI_Mm01_00186724 predicted 429
8 SASI_Mm01_00186725 predicted 334
9 SASI_Mm01_00186726 predicted 602
10 SASI_Mm02_00289929 predicted 1011
11 SASI_Mm01_00186727 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190171 predicted 326
2 SASI_Mm01_00190172 predicted 1258
3 SASI_Mm01_00190173 predicted 952
4 SASI_Mm01_00190174 predicted 294
5 SASI_Mm01_00190175 predicted 443
6 SASI_Mm01_00190176 predicted 827
7 SASI_Mm01_00190177 predicted 431
8 SASI_Mm01_00190178 predicted 338
9 SASI_Mm01_00190179 predicted 602
10 SASI_Mm02_00289930 predicted 1012
11 SASI_Mm01_00190180 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289931 predicted 369
2 SASI_Mm01_00150534 predicted 676
3 SASI_Mm01_00150535 predicted 328
4 SASI_Mm01_00150536 predicted 714
5 SASI_Mm01_00150538 predicted 315
6 SASI_Mm01_00150539 predicted 764
7 SASI_Mm01_00150541 predicted 434
8 SASI_Mm02_00289932 predicted 775
9 SASI_Mm01_00150542 predicted 950
10 SASI_Mm01_00150543 predicted 424
11 SASI_Mm01_00150537 predicted 303
12 SASI_Mm01_00150540 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321755 predicted 362
2 SASI_Mm01_00125888 predicted 332
3 SASI_Mm01_00125889 predicted 718
4 SASI_Mm01_00125891 predicted 314
5 SASI_Mm01_00125892 predicted 761
6 SASI_Mm01_00125894 predicted 431
7 SASI_Mm01_00125895 predicted 1003
8 SASI_Mm01_00125896 predicted 428
9 SASI_Mm02_00321756 predicted 703
10 SASI_Mm01_00125897 predicted 982
11 SASI_Mm01_00125890 predicted 305
12 SASI_Mm01_00125893 predicted 781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011926
VALIDATED
CEACAM1 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-234s1c2
Sequence:CCGGCCTGTGTCTACAAACGCTGAACTCGAGTTCAGCGTTTGTAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-886s1c1
Sequence:CCGGCCAACCACAATCTGGCTCCTTCTCGAGAAGGAGCCAGATTGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-234s1c1
Sequence:CCGGCCTGTGTCTACAAACGCTGAACTCGAGTTCAGCGTTTGTAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-420s1c1
Sequence:CCGGGCGACTGTGCAATTTCATGTACTCGAGTACATGAAATTGCACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-695s1c1
Sequence:CCGGCAACTCAATCAAGCTGGACATCTCGAGATGTCCAGCTTGATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011926.1-212s1c1
Sequence:CCGGCTTTGCTTGGTACAAGGGAAACTCGAGTTTCCCTTGTACCAAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011926
VALIDATED
CEACAM1 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-234s1c2
Sequence:CCGGCCTGTGTCTACAAACGCTGAACTCGAGTTCAGCGTTTGTAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-886s1c1
Sequence:CCGGCCAACCACAATCTGGCTCCTTCTCGAGAAGGAGCCAGATTGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-234s1c1
Sequence:CCGGCCTGTGTCTACAAACGCTGAACTCGAGTTCAGCGTTTGTAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-420s1c1
Sequence:CCGGGCGACTGTGCAATTTCATGTACTCGAGTACATGAAATTGCACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-695s1c1
Sequence:CCGGCAACTCAATCAAGCTGGACATCTCGAGATGTCCAGCTTGATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011926.1-212s1c1
Sequence:CCGGCTTTGCTTGGTACAAGGGAAACTCGAGTTTCCCTTGTACCAAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011926
VALIDATED
CEACAM1 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-234s1c2
Sequence:CCGGCCTGTGTCTACAAACGCTGAACTCGAGTTCAGCGTTTGTAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-886s1c1
Sequence:CCGGCCAACCACAATCTGGCTCCTTCTCGAGAAGGAGCCAGATTGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-234s1c1
Sequence:CCGGCCTGTGTCTACAAACGCTGAACTCGAGTTCAGCGTTTGTAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-420s1c1
Sequence:CCGGGCGACTGTGCAATTTCATGTACTCGAGTACATGAAATTGCACAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011926.1-695s1c1
Sequence:CCGGCAACTCAATCAAGCTGGACATCTCGAGATGTCCAGCTTGATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011926.1-212s1c1
Sequence:CCGGCTTTGCTTGGTACAAGGGAAACTCGAGTTTCCCTTGTACCAAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001712
CEACAM1 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001712.2-1522s1c1
Sequence:CCGGCCACCTAACAAGATGAATGAACTCGAGTTCATTCATCTTGTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001712.2-881s1c1
Sequence:CCGGCCTGGCTTATCAATGGAACATCTCGAGATGTTCCATTGATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001712.2-1248s1c1
Sequence:CCGGGACGTATTGGTGTGAGGTCTTCTCGAGAAGACCTCACACCAATACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001712.3-1338s21c1
Sequence:CCGGCCCATCATGCTGAACGTAAACCTCGAGGTTTACGTTCAGCATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001712.3-2050s21c1
Sequence:CCGGCTATCACTCTAATTCGGATTTCTCGAGAAATCCGAATTAGAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001712.3-1906s21c1
Sequence:CCGGCAACCTTCTTGTCATTGAAATCTCGAGATTTCAATGACAAGAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001712
CEACAM1 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001712.2-1522s1c1
Sequence:CCGGCCACCTAACAAGATGAATGAACTCGAGTTCATTCATCTTGTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001712.2-881s1c1
Sequence:CCGGCCTGGCTTATCAATGGAACATCTCGAGATGTTCCATTGATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001712.2-1248s1c1
Sequence:CCGGGACGTATTGGTGTGAGGTCTTCTCGAGAAGACCTCACACCAATACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001712.3-1338s21c1
Sequence:CCGGCCCATCATGCTGAACGTAAACCTCGAGGTTTACGTTCAGCATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001712.3-2050s21c1
Sequence:CCGGCTATCACTCTAATTCGGATTTCTCGAGAAATCCGAATTAGAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001712.3-1906s21c1
Sequence:CCGGCAACCTTCTTGTCATTGAAATCTCGAGATTTCAATGACAAGAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001712
CEACAM1 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001712.2-1522s1c1
Sequence:CCGGCCACCTAACAAGATGAATGAACTCGAGTTCATTCATCTTGTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001712.2-881s1c1
Sequence:CCGGCCTGGCTTATCAATGGAACATCTCGAGATGTTCCATTGATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001712.2-1248s1c1
Sequence:CCGGGACGTATTGGTGTGAGGTCTTCTCGAGAAGACCTCACACCAATACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001712.3-1338s21c1
Sequence:CCGGCCCATCATGCTGAACGTAAACCTCGAGGTTTACGTTCAGCATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001712.3-2050s21c1
Sequence:CCGGCTATCACTCTAATTCGGATTTCTCGAGAAATCCGAATTAGAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001712.3-1906s21c1
Sequence:CCGGCAACCTTCTTGTCATTGAAATCTCGAGATTTCAATGACAAGAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks