EMAIL THIS PAGE TO A FRIEND

CEACAM20

carcinoembryonic antigen-related cell adhesion molecule 20

90 Gene Product Result for
Synonyms: UNQ9366
UniProtKB ID: Q6UY09
Gene ID:
Mouse(71601) carcinoembryonic antigen-related cell adhesion molecule 20
Rat(292701) carcinoembryonic antigen-related cell adhesion molecule 20
naked mole-rat(101711809) carcinoembryonic antigen-related cell adhesion molecule 20
domestic guinea pig(100717443) carcinoembryonic antigen-related cell adhesion molecule 20
sheep(101110170) carcinoembryonic antigen-related cell adhesion molecule 20
dog(476441) carcinoembryonic antigen-related cell adhesion molecule 20
domestic cat(101097285) carcinoembryonic antigen-related cell adhesion molecule 20
cow(100848884) carcinoembryonic antigen-related cell adhesion molecule 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198444 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102597 Rosetta Predictions human pricing
NM_001102598 Rosetta Predictions human pricing
NM_001102599 Rosetta Predictions human pricing
NM_001102600 Rosetta Predictions human pricing
NM_198444 Rosetta Predictions human pricing
XM_001076225 Rosetta Predictions rat pricing
XM_218430 Rosetta Predictions rat pricing
NM_027839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323320 predicted 604
2 SASI_Hs02_00323321 predicted 280
3 SASI_Hs02_00323322 predicted 688
4 SASI_Hs02_00323323 predicted 637
5 SASI_Hs02_00323324 predicted 563
6 SASI_Hs02_00323325 predicted 773
7 SASI_Hs02_00323326 predicted 372
8 SASI_Hs02_00323327 predicted 213
9 SASI_Hs02_00323328 predicted 287
10 SASI_Hs02_00323329 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323330 predicted 606
2 SASI_Hs02_00323331 predicted 283
3 SASI_Hs02_00323332 predicted 692
4 SASI_Hs02_00323333 predicted 630
5 SASI_Hs02_00323334 predicted 563
6 SASI_Hs02_00323335 predicted 777
7 SASI_Hs02_00323336 predicted 370
8 SASI_Hs02_00323337 predicted 209
9 SASI_Hs02_00323338 predicted 283
10 SASI_Hs02_00323339 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323340 predicted 599
2 SASI_Hs02_00323341 predicted 284
3 SASI_Hs02_00323342 predicted 686
4 SASI_Hs02_00323343 predicted 628
5 SASI_Hs02_00323344 predicted 562
6 SASI_Hs02_00323345 predicted 779
7 SASI_Hs02_00323346 predicted 370
8 SASI_Hs02_00323347 predicted 212
9 SASI_Hs02_00323348 predicted 285
10 SASI_Hs02_00323349 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323350 predicted 604
2 SASI_Hs02_00323351 predicted 283
3 SASI_Hs02_00323352 predicted 686
4 SASI_Hs02_00323353 predicted 634
5 SASI_Hs02_00323354 predicted 570
6 SASI_Hs02_00323355 predicted 780
7 SASI_Hs02_00323356 predicted 366
8 SASI_Hs02_00323357 predicted 211
9 SASI_Hs02_00323358 predicted 286
10 SASI_Hs02_00323359 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132344 predicted 839
2 SASI_Hs01_00132345 predicted 870
3 SASI_Hs01_00132346 predicted 549
4 SASI_Hs01_00132347 predicted 1628
5 SASI_Hs01_00132348 predicted 1309
6 SASI_Hs01_00132349 predicted 959
7 SASI_Hs01_00132350 predicted 324
8 SASI_Hs01_00132351 predicted 410
9 SASI_Hs01_00132352 predicted 554
10 SASI_Hs01_00132353 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352456 predicted 1466
2 SASI_Rn02_00352457 predicted 1130
3 SASI_Rn02_00352458 predicted 345
4 SASI_Rn02_00352459 predicted 237
5 SASI_Rn02_00352460 predicted 1296
6 SASI_Rn02_00352461 predicted 912
7 SASI_Rn02_00352462 predicted 1088
8 SASI_Rn02_00352463 predicted 1479
9 SASI_Rn02_00352464 predicted 1143
10 SASI_Rn02_00352465 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218430 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377721 predicted 337
2 SASI_Rn02_00377722 predicted 234
3 SASI_Rn02_00377723 predicted 197
4 SASI_Rn02_00377724 predicted 903
5 SASI_Rn02_00377725 predicted 790
6 SASI_Rn02_00377726 predicted 343
7 SASI_Rn02_00377727 predicted 206
8 SASI_Rn02_00377728 predicted 889
9 SASI_Rn02_00377729 predicted 870
10 SASI_Rn02_00377730 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036597 predicted 1470
2 SASI_Mm01_00036598 predicted 1848
3 SASI_Mm02_00332801 predicted 970
4 SASI_Mm01_00036599 predicted 1730
5 SASI_Mm01_00036600 predicted 1161
6 SASI_Mm02_00332802 predicted 1105
7 SASI_Mm01_00036602 predicted 801
8 SASI_Mm01_00036603 predicted 699
9 SASI_Mm01_00036604 predicted 973
10 SASI_Mm01_00036605 predicted 1169
11 SASI_Mm01_00036601 predicted 774
12 SASI_Mm01_00036606 predicted 1525
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027839
CEACAM20 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 20
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000094594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027839.1-1861s1c1
Sequence:CCGGGCACTTTAGAATCCAGCCATTCTCGAGAATGGCTGGATTCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027839.1-216s1c1
Sequence:CCGGCCTCACAGTCAATCAGAGCATCTCGAGATGCTCTGATTGACTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027839.1-324s1c1
Sequence:CCGGGCTTGTGTTGAATGAGCGCATCTCGAGATGCGCTCATTCAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027839.1-1755s1c1
Sequence:CCGGCCATAGTCTTTACTGCAAGATCTCGAGATCTTGCAGTAAAGACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027839
CEACAM20 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 20
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000094594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027839.1-1861s1c1
Sequence:CCGGGCACTTTAGAATCCAGCCATTCTCGAGAATGGCTGGATTCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027839.1-216s1c1
Sequence:CCGGCCTCACAGTCAATCAGAGCATCTCGAGATGCTCTGATTGACTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027839.1-324s1c1
Sequence:CCGGGCTTGTGTTGAATGAGCGCATCTCGAGATGCGCTCATTCAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027839.1-1755s1c1
Sequence:CCGGCCATAGTCTTTACTGCAAGATCTCGAGATCTTGCAGTAAAGACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027839
CEACAM20 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 20
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000094594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027839.1-1861s1c1
Sequence:CCGGGCACTTTAGAATCCAGCCATTCTCGAGAATGGCTGGATTCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027839.1-216s1c1
Sequence:CCGGCCTCACAGTCAATCAGAGCATCTCGAGATGCTCTGATTGACTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027839.1-324s1c1
Sequence:CCGGGCTTGTGTTGAATGAGCGCATCTCGAGATGCGCTCATTCAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027839.1-1755s1c1
Sequence:CCGGCCATAGTCTTTACTGCAAGATCTCGAGATCTTGCAGTAAAGACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198444
CEACAM20 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 20
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-1290s1c1
Sequence:CCGGCCTTGAGCTGACCATCAACTACTCGAGTAGTTGATGGTCAGCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-757s1c1
Sequence:CCGGCCTGATCCTGTTGAAATCAAACTCGAGTTTGATTTCAACAGGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-1291s1c1
Sequence:CCGGCTTGAGCTGACCATCAACTATCTCGAGATAGTTGATGGTCAGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-742s1c1
Sequence:CCGGGATGTGAAGTATGGTCCTGATCTCGAGATCAGGACCATACTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-415s1c1
Sequence:CCGGGATGTTGTTCTGCCTGTGTTTCTCGAGAAACACAGGCAGAACAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-871s1c1
Sequence:CCGGGCCTATACTTGGTTTCTCCTTCTCGAGAAGGAGAAACCAAGTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-1113s1c1
Sequence:CCGGCGTCAATCAGAGTGTGAATGTCTCGAGACATTCACACTCTGATTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-639s1c1
Sequence:CCGGCAAGATCCTCACCATTCTCATCTCGAGATGAGAATGGTGAGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-588s1c1
Sequence:CCGGCAACAACCTCTCCATTGTGTTCTCGAGAACACAATGGAGAGGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198444
CEACAM20 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 20
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-1290s1c1
Sequence:CCGGCCTTGAGCTGACCATCAACTACTCGAGTAGTTGATGGTCAGCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-757s1c1
Sequence:CCGGCCTGATCCTGTTGAAATCAAACTCGAGTTTGATTTCAACAGGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-1291s1c1
Sequence:CCGGCTTGAGCTGACCATCAACTATCTCGAGATAGTTGATGGTCAGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-742s1c1
Sequence:CCGGGATGTGAAGTATGGTCCTGATCTCGAGATCAGGACCATACTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-415s1c1
Sequence:CCGGGATGTTGTTCTGCCTGTGTTTCTCGAGAAACACAGGCAGAACAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-871s1c1
Sequence:CCGGGCCTATACTTGGTTTCTCCTTCTCGAGAAGGAGAAACCAAGTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-1113s1c1
Sequence:CCGGCGTCAATCAGAGTGTGAATGTCTCGAGACATTCACACTCTGATTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-639s1c1
Sequence:CCGGCAAGATCCTCACCATTCTCATCTCGAGATGAGAATGGTGAGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-588s1c1
Sequence:CCGGCAACAACCTCTCCATTGTGTTCTCGAGAACACAATGGAGAGGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198444
CEACAM20 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 20
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-1290s1c1
Sequence:CCGGCCTTGAGCTGACCATCAACTACTCGAGTAGTTGATGGTCAGCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-757s1c1
Sequence:CCGGCCTGATCCTGTTGAAATCAAACTCGAGTTTGATTTCAACAGGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-1291s1c1
Sequence:CCGGCTTGAGCTGACCATCAACTATCTCGAGATAGTTGATGGTCAGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-742s1c1
Sequence:CCGGGATGTGAAGTATGGTCCTGATCTCGAGATCAGGACCATACTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-415s1c1
Sequence:CCGGGATGTTGTTCTGCCTGTGTTTCTCGAGAAACACAGGCAGAACAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-871s1c1
Sequence:CCGGGCCTATACTTGGTTTCTCCTTCTCGAGAAGGAGAAACCAAGTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-1113s1c1
Sequence:CCGGCGTCAATCAGAGTGTGAATGTCTCGAGACATTCACACTCTGATTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-639s1c1
Sequence:CCGGCAAGATCCTCACCATTCTCATCTCGAGATGAGAATGGTGAGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198444.1-588s1c1
Sequence:CCGGCAACAACCTCTCCATTGTGTTCTCGAGAACACAATGGAGAGGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks