EMAIL THIS PAGE TO A FRIEND

CEACAM21

carcinoembryonic antigen-related cell adhesion molecule 21

115 Gene Product Result for
Synonyms: CEACAM3 R29124_1
UniProtKB ID: Q3KPI0, B7WNQ6, O75296, Q6UY47, Q96ER7
Gene ID:
dog(491477) carcinoembryonic antigen-related cell adhesion molecule 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033543 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119631 MISSION® esiRNA esiRNA human CEACAM21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098506 Rosetta Predictions human pricing
NM_033543 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319137 predicted 318
2 SASI_Hs02_00319138 predicted 269
3 SASI_Hs02_00319139 predicted 251
4 SASI_Hs02_00319140 predicted 443
5 SASI_Hs02_00319141 predicted 210
6 SASI_Hs02_00319142 predicted 319
7 SASI_Hs02_00319143 predicted 276
8 SASI_Hs02_00319144 predicted 423
9 SASI_Hs02_00319145 predicted 388
10 SASI_Hs02_00319146 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361417 predicted 321
2 SASI_Hs02_00361418 predicted 269
3 SASI_Hs01_00115911 predicted 260
4 SASI_Hs01_00115912 predicted 438
5 SASI_Hs02_00361419 predicted 215
6 SASI_Hs01_00115913 predicted 318
7 SASI_Hs01_00115914 predicted 276
8 SASI_Hs01_00115915 predicted 426
9 SASI_Hs01_00115918 predicted 390
10 SASI_Hs02_00361420 predicted 451
11 SASI_Hs01_00115909 predicted 438
12 SASI_Hs01_00115910 predicted 423
13 SASI_Hs01_00115916 predicted 396
14 SASI_Hs01_00115917 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033543
CEACAM21 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-231s1c1
Sequence:CCGGGCTAATCGCAGCATATGTAATCTCGAGATTACATATGCTGCGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-503s1c1
Sequence:CCGGCAAATAACACTGGAACCTCTTCTCGAGAAGAGGTTCCAGTGTTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-147s1c1
Sequence:CCGGGAATGTTCATCTCTCTGTGGTCTCGAGACCACAGAGAGATGAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-238s1c1
Sequence:CCGGGCAGCATATGTAATAGACACTCTCGAGAGTGTCTATTACATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-363s1c1
Sequence:CCGGCCTACAAGTCACATACAGAAACTCGAGTTTCTGTATGTGACTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033543.3-498s21c1
Sequence:CCGGATCTCACCATCTCCGTGTATACTCGAGTATACACGGAGATGGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033543.3-284s21c1
Sequence:CCGGACAGCTATGGCTGGTACAAAGCTCGAGCTTTGTACCAGCCATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033543.3-663s21c1
Sequence:CCGGGATGAAGCTGTCCTGGTTTAACTCGAGTTAAACCAGGACAGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033543
CEACAM21 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-231s1c1
Sequence:CCGGGCTAATCGCAGCATATGTAATCTCGAGATTACATATGCTGCGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-503s1c1
Sequence:CCGGCAAATAACACTGGAACCTCTTCTCGAGAAGAGGTTCCAGTGTTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-147s1c1
Sequence:CCGGGAATGTTCATCTCTCTGTGGTCTCGAGACCACAGAGAGATGAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-238s1c1
Sequence:CCGGGCAGCATATGTAATAGACACTCTCGAGAGTGTCTATTACATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-363s1c1
Sequence:CCGGCCTACAAGTCACATACAGAAACTCGAGTTTCTGTATGTGACTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033543.3-498s21c1
Sequence:CCGGATCTCACCATCTCCGTGTATACTCGAGTATACACGGAGATGGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033543.3-284s21c1
Sequence:CCGGACAGCTATGGCTGGTACAAAGCTCGAGCTTTGTACCAGCCATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033543.3-663s21c1
Sequence:CCGGGATGAAGCTGTCCTGGTTTAACTCGAGTTAAACCAGGACAGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033543
CEACAM21 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-231s1c1
Sequence:CCGGGCTAATCGCAGCATATGTAATCTCGAGATTACATATGCTGCGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-503s1c1
Sequence:CCGGCAAATAACACTGGAACCTCTTCTCGAGAAGAGGTTCCAGTGTTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-147s1c1
Sequence:CCGGGAATGTTCATCTCTCTGTGGTCTCGAGACCACAGAGAGATGAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-238s1c1
Sequence:CCGGGCAGCATATGTAATAGACACTCTCGAGAGTGTCTATTACATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033543.1-363s1c1
Sequence:CCGGCCTACAAGTCACATACAGAAACTCGAGTTTCTGTATGTGACTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033543.3-498s21c1
Sequence:CCGGATCTCACCATCTCCGTGTATACTCGAGTATACACGGAGATGGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033543.3-284s21c1
Sequence:CCGGACAGCTATGGCTGGTACAAAGCTCGAGCTTTGTACCAGCCATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033543.3-663s21c1
Sequence:CCGGGATGAAGCTGTCCTGGTTTAACTCGAGTTAAACCAGGACAGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks