EMAIL THIS PAGE TO A FRIEND

CEACAM3

carcinoembryonic antigen-related cell adhesion molecule 3

Synonyms: CD66D CEA CGM1 W264 W282
UniProtKB ID: P40198, Q3KPH9
Gene ID:
Human(1084) Summary: This gene encodes a member of the family of carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), which are used by several bacterial pathogens to bind and invade host cells. The encoded transmembrane protein directs phagocytosis of several bacterial species that is dependent on the small GTPase Rac. It is thought to serve an important role in controlling human-specific pathogens by the innate immune system. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2013]
Mouse(384557) carcinoembryonic antigen-related cell adhesion molecule 3
Rat(24926) carcinoembryonic antigen-related cell adhesion molecule 3
domestic guinea pig(101787875) carcinoembryonic antigen-related cell adhesion molecule 3
naked mole-rat(101702667) carcinoembryonic antigen-related cell adhesion molecule 3
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
C3330 Carcinoembryonic Antigen Fragment 101-115 ≥95% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001815 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_357710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_357710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_357710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001815 Rosetta Predictions human pricing
NM_012702 Rosetta Predictions rat pricing
XM_357710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122229 predicted 581
2 SASI_Hs01_00122237 predicted 931
3 SASI_Hs01_00122231 predicted 912
4 SASI_Hs02_00332599 predicted 746
5 SASI_Hs01_00122233 predicted 927
6 SASI_Hs01_00122234 predicted 921
7 SASI_Hs01_00122232 predicted 485
8 SASI_Hs01_00122230 predicted 677
9 SASI_Hs01_00122235 predicted 696
10 SASI_Hs01_00122236 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260016 predicted 1421
2 SASI_Rn01_00091621 predicted 1778
3 SASI_Rn01_00091623 predicted 1901
4 SASI_Rn01_00091624 predicted 2180
5 SASI_Rn01_00091625 predicted 1265
6 SASI_Rn01_00091626 predicted 1088
7 SASI_Rn01_00091627 predicted 553
8 SASI_Rn02_00260017 predicted 1460
9 SASI_Rn02_00260018 predicted 1393
10 SASI_Rn01_00091622 predicted 1781
11 SASI_Rn01_00091628 predicted 362
12 SASI_Rn01_00091629 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426131 predicted 1233
2 SASI_Mm02_00426132 predicted 880
3 SASI_Mm02_00426133 predicted 701
4 SASI_Mm02_00426134 predicted 1625
5 SASI_Mm02_00426135 predicted 1270
6 SASI_Mm02_00426136 predicted 1537
7 SASI_Mm02_00426137 predicted 548
8 SASI_Mm02_00426138 predicted 634
9 SASI_Mm02_00426139 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001815
CEACAM3 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001815.2-189s21c1
Sequence:CCGGTTGAATCCATGCCGCTCAGTGCTCGAGCACTGAGCGGCATGGATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001815.2-920s21c1
Sequence:CCGGGCCAGAGAACCAGCTATAAGTCTCGAGACTTATAGCTGGTTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001815.2-687s21c1
Sequence:CCGGACAGCTCTGCCTTCTCGATGTCTCGAGACATCGAGAAGGCAGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001815.2-797s21c1
Sequence:CCGGTACTGCCGGATGGACCACAAACTCGAGTTTGTGGTCCATCCGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-278s1c1
Sequence:CCGGGCAACAGTCTAATTGTGGGATCTCGAGATCCCACAATTAGACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-562s1c1
Sequence:CCGGCTGGTGTGTTTCCTGCTCCTTCTCGAGAAGGAGCAGGAAACACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-669s1c1
Sequence:CCGGCCAGGACAGCAGCTTCCATCTCTCGAGAGATGGAAGCTGCTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-346s1c1
Sequence:CCGGCGAGAGACAATATACACCAATCTCGAGATTGGTGTATATTGTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001815
CEACAM3 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001815.2-189s21c1
Sequence:CCGGTTGAATCCATGCCGCTCAGTGCTCGAGCACTGAGCGGCATGGATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001815.2-920s21c1
Sequence:CCGGGCCAGAGAACCAGCTATAAGTCTCGAGACTTATAGCTGGTTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001815.2-687s21c1
Sequence:CCGGACAGCTCTGCCTTCTCGATGTCTCGAGACATCGAGAAGGCAGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001815.2-797s21c1
Sequence:CCGGTACTGCCGGATGGACCACAAACTCGAGTTTGTGGTCCATCCGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-278s1c1
Sequence:CCGGGCAACAGTCTAATTGTGGGATCTCGAGATCCCACAATTAGACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-562s1c1
Sequence:CCGGCTGGTGTGTTTCCTGCTCCTTCTCGAGAAGGAGCAGGAAACACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-669s1c1
Sequence:CCGGCCAGGACAGCAGCTTCCATCTCTCGAGAGATGGAAGCTGCTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-346s1c1
Sequence:CCGGCGAGAGACAATATACACCAATCTCGAGATTGGTGTATATTGTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001815
CEACAM3 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001815.2-189s21c1
Sequence:CCGGTTGAATCCATGCCGCTCAGTGCTCGAGCACTGAGCGGCATGGATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001815.2-920s21c1
Sequence:CCGGGCCAGAGAACCAGCTATAAGTCTCGAGACTTATAGCTGGTTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001815.2-687s21c1
Sequence:CCGGACAGCTCTGCCTTCTCGATGTCTCGAGACATCGAGAAGGCAGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001815.2-797s21c1
Sequence:CCGGTACTGCCGGATGGACCACAAACTCGAGTTTGTGGTCCATCCGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-278s1c1
Sequence:CCGGGCAACAGTCTAATTGTGGGATCTCGAGATCCCACAATTAGACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-562s1c1
Sequence:CCGGCTGGTGTGTTTCCTGCTCCTTCTCGAGAAGGAGCAGGAAACACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-669s1c1
Sequence:CCGGCCAGGACAGCAGCTTCCATCTCTCGAGAGATGGAAGCTGCTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001815.1-346s1c1
Sequence:CCGGCGAGAGACAATATACACCAATCTCGAGATTGGTGTATATTGTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_357710
CEACAM3 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_357710.3-3483s1c1
Sequence:CCGGGCTGTGATAAAGACATCCTTTCTCGAGAAAGGATGTCTTTATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-964s1c1
Sequence:CCGGCGGTATGTAATAGCCAAGAATCTCGAGATTCTTGGCTATTACATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-1924s1c1
Sequence:CCGGCCAGGGAATCTTACAGCCTTTCTCGAGAAAGGCTGTAAGATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-2105s1c1
Sequence:CCGGCCTTCAATAAACATGCAGAAACTCGAGTTTCTGCATGTTTATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-457s1c1
Sequence:CCGGGCTCGAAATCTTCCAGAGAATCTCGAGATTCTCTGGAAGATTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_357710
CEACAM3 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_357710.3-3483s1c1
Sequence:CCGGGCTGTGATAAAGACATCCTTTCTCGAGAAAGGATGTCTTTATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-964s1c1
Sequence:CCGGCGGTATGTAATAGCCAAGAATCTCGAGATTCTTGGCTATTACATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-1924s1c1
Sequence:CCGGCCAGGGAATCTTACAGCCTTTCTCGAGAAAGGCTGTAAGATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-2105s1c1
Sequence:CCGGCCTTCAATAAACATGCAGAAACTCGAGTTTCTGCATGTTTATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-457s1c1
Sequence:CCGGGCTCGAAATCTTCCAGAGAATCTCGAGATTCTCTGGAAGATTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_357710
CEACAM3 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_357710.3-3483s1c1
Sequence:CCGGGCTGTGATAAAGACATCCTTTCTCGAGAAAGGATGTCTTTATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-964s1c1
Sequence:CCGGCGGTATGTAATAGCCAAGAATCTCGAGATTCTTGGCTATTACATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-1924s1c1
Sequence:CCGGCCAGGGAATCTTACAGCCTTTCTCGAGAAAGGCTGTAAGATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-2105s1c1
Sequence:CCGGCCTTCAATAAACATGCAGAAACTCGAGTTTCTGCATGTTTATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357710.3-457s1c1
Sequence:CCGGGCTCGAAATCTTCCAGAGAATCTCGAGATTCTCTGGAAGATTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks