EMAIL THIS PAGE TO A FRIEND

CEACAM4

carcinoembryonic antigen-related cell adhesion molecule 4

Synonyms: CGM7 CGM7_HUMAN NCA
Species: Human CEACAM4(1089)
UniProtKB ID: O75871, Q03715, Q7LDZ7
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001817 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001817 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237925 predicted 491
2 SASI_Hs01_00237926 predicted 340
3 SASI_Hs01_00237928 predicted 280
4 SASI_Hs01_00237930 predicted 286
5 SASI_Hs01_00237932 predicted 260
6 SASI_Hs01_00237933 predicted 459
7 SASI_Hs01_00237934 predicted 464
8 SASI_Hs02_00332600 predicted 466
9 SASI_Hs02_00332601 predicted 338
10 SASI_Hs01_00237929 predicted 206
11 SASI_Hs01_00237927 predicted 772
12 SASI_Hs01_00237931 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001817
CEACAM4 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-190s1c1
Sequence:CCGGCACCACTGTCCAGTTCACTATCTCGAGATAGTGAACTGGACAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-480s1c1
Sequence:CCGGGTTACGACTCTGACCAAGCAACTCGAGTTGCTTGGTCAGAGTCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-233s1c1
Sequence:CCGGGCAGAGGGAAAGGATGTTCTTCTCGAGAAGAACATCCTTTCCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001817.1-800s1c1
Sequence:CCGGCAGATCGACCACAAAGCAGATCTCGAGATCTGCTTTGTGGTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-257s1c1
Sequence:CCGGCTGGCCTGCAATATTTCAGAACTCGAGTTCTGAAATATTGCAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-811s1c1
Sequence:CCGGCAAAGCAGATGTGGTCTCTTACTCGAGTAAGAGACCACATCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001817
CEACAM4 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-190s1c1
Sequence:CCGGCACCACTGTCCAGTTCACTATCTCGAGATAGTGAACTGGACAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-480s1c1
Sequence:CCGGGTTACGACTCTGACCAAGCAACTCGAGTTGCTTGGTCAGAGTCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-233s1c1
Sequence:CCGGGCAGAGGGAAAGGATGTTCTTCTCGAGAAGAACATCCTTTCCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001817.1-800s1c1
Sequence:CCGGCAGATCGACCACAAAGCAGATCTCGAGATCTGCTTTGTGGTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-257s1c1
Sequence:CCGGCTGGCCTGCAATATTTCAGAACTCGAGTTCTGAAATATTGCAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-811s1c1
Sequence:CCGGCAAAGCAGATGTGGTCTCTTACTCGAGTAAGAGACCACATCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001817
CEACAM4 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-190s1c1
Sequence:CCGGCACCACTGTCCAGTTCACTATCTCGAGATAGTGAACTGGACAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-480s1c1
Sequence:CCGGGTTACGACTCTGACCAAGCAACTCGAGTTGCTTGGTCAGAGTCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-233s1c1
Sequence:CCGGGCAGAGGGAAAGGATGTTCTTCTCGAGAAGAACATCCTTTCCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001817.1-800s1c1
Sequence:CCGGCAGATCGACCACAAAGCAGATCTCGAGATCTGCTTTGTGGTCGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-257s1c1
Sequence:CCGGCTGGCCTGCAATATTTCAGAACTCGAGTTCTGAAATATTGCAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001817.1-811s1c1
Sequence:CCGGCAAAGCAGATGTGGTCTCTTACTCGAGTAAGAGACCACATCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks