EMAIL THIS PAGE TO A FRIEND

CEACAM5

carcinoembryonic antigen-related cell adhesion molecule 5

85 Gene Product Result for
Synonyms: CD66e CEA
UniProtKB ID: P06731
Gene ID:
Human(1048) Summary: Members of the CEACAM subfamily, including CEACAM5, belong to the CEA gene family. For general information on the CEA gene family, see CEACAM1 (MIM 109770).[supplied by OMIM, Oct 2009]
Mouse(73250) carcinoembryonic antigen-related cell adhesion molecule 5
cow(282174) carcinoembryonic antigen
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004363 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122231 MISSION® esiRNA esiRNA human CEACAM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004363 Rosetta Predictions human pricing
NM_028480 Rosetta Predictions mouse pricing
XM_145406 Rosetta Predictions mouse pricing
XM_900489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159717 predicted 1986
2 SASI_Hs01_00159718 predicted 1990
3 SASI_Hs01_00159719 predicted 1999
4 SASI_Hs01_00159720 predicted 1298
5 SASI_Hs01_00159721 predicted 716
6 SASI_Hs01_00159722 predicted 2055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333939 predicted 1017
2 SASI_Mm02_00333940 predicted 1191
3 SASI_Mm02_00333941 predicted 1301
4 SASI_Mm02_00333942 predicted 360
5 SASI_Mm02_00333943 predicted 1724
6 SASI_Mm02_00333944 predicted 1633
7 SASI_Mm02_00333945 predicted 573
8 SASI_Mm02_00333946 predicted 1214
9 SASI_Mm02_00333947 predicted 1030
10 SASI_Mm02_00333948 predicted 1910
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_145406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254220 predicted 1031
2 SASI_Mm01_00254221 predicted 1131
3 SASI_Mm01_00254222 predicted 2470
4 SASI_Mm01_00254223 predicted 1328
5 SASI_Mm01_00254224 predicted 382
6 SASI_Mm01_00254225 predicted 1743
7 SASI_Mm01_00254226 predicted 1052
8 SASI_Mm01_00254227 predicted 1518
9 SASI_Mm01_00254228 predicted 1400
10 SASI_Mm01_00254229 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206134 predicted 1032
2 SASI_Mm01_00206135 predicted 1212
3 SASI_Mm01_00206136 predicted 1130
4 SASI_Mm01_00206137 predicted 2128
5 SASI_Mm01_00206138 predicted 1328
6 SASI_Mm01_00206139 predicted 381
7 SASI_Mm01_00206140 predicted 587
8 SASI_Mm01_00206141 predicted 1048
9 SASI_Mm01_00206142 predicted 1509
10 SASI_Mm01_00206143 predicted 1397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004363
CEACAM5 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004363.1-2799s1c1
Sequence:CCGGCCACTCTTACAGCAATTTGATCTCGAGATCAAATTGCTGTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-1447s1c1
Sequence:CCGGGCACAGTATTCTTGGCTGATTCTCGAGAATCAGCCAAGAATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-2051s1c1
Sequence:CCGGCGCCAAATAATAACGGGACCTCTCGAGAGGTCCCGTTATTATTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-1983s1c1
Sequence:CCGGGCAGTATTCTTGGCGTATCAACTCGAGTTGATACGCCAAGAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-2053s1c1
Sequence:CCGGCCAAATAATAACGGGACCTATCTCGAGATAGGTCCCGTTATTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004363.2-1527s21c1
Sequence:CCGGAGAAGAACAGCGGACTCTATACTCGAGTATAGAGTCCGCTGTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004363
CEACAM5 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004363.1-2799s1c1
Sequence:CCGGCCACTCTTACAGCAATTTGATCTCGAGATCAAATTGCTGTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-1447s1c1
Sequence:CCGGGCACAGTATTCTTGGCTGATTCTCGAGAATCAGCCAAGAATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-2051s1c1
Sequence:CCGGCGCCAAATAATAACGGGACCTCTCGAGAGGTCCCGTTATTATTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-1983s1c1
Sequence:CCGGGCAGTATTCTTGGCGTATCAACTCGAGTTGATACGCCAAGAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-2053s1c1
Sequence:CCGGCCAAATAATAACGGGACCTATCTCGAGATAGGTCCCGTTATTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004363.2-1527s21c1
Sequence:CCGGAGAAGAACAGCGGACTCTATACTCGAGTATAGAGTCCGCTGTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004363
CEACAM5 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004363.1-2799s1c1
Sequence:CCGGCCACTCTTACAGCAATTTGATCTCGAGATCAAATTGCTGTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-1447s1c1
Sequence:CCGGGCACAGTATTCTTGGCTGATTCTCGAGAATCAGCCAAGAATACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-2051s1c1
Sequence:CCGGCGCCAAATAATAACGGGACCTCTCGAGAGGTCCCGTTATTATTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-1983s1c1
Sequence:CCGGGCAGTATTCTTGGCGTATCAACTCGAGTTGATACGCCAAGAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004363.1-2053s1c1
Sequence:CCGGCCAAATAATAACGGGACCTATCTCGAGATAGGTCCCGTTATTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004363.2-1527s21c1
Sequence:CCGGAGAAGAACAGCGGACTCTATACTCGAGTATAGAGTCCGCTGTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028480
CEACAM5 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-2446s21c1
Sequence:CCGGGTACCAGTGCCTCGGAATATTCTCGAGAATATTCCGAGGCACTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028480.2-3057s21c1
Sequence:CCGGTACAGCAGAGTGGAGTCATTTCTCGAGAAATGACTCCACTCTGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-1215s21c1
Sequence:CCGGCAACGGATCCATGCTAATAATCTCGAGATTATTAGCATGGATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-433s21c1
Sequence:CCGGCAATATACACCGGCCACTAAACTCGAGTTTAGTGGCCGGTGTATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-1816s21c1
Sequence:CCGGTGGTATAAACCAGCGTATAAGCTCGAGCTTATACGCTGGTTTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028480
CEACAM5 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-2446s21c1
Sequence:CCGGGTACCAGTGCCTCGGAATATTCTCGAGAATATTCCGAGGCACTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028480.2-3057s21c1
Sequence:CCGGTACAGCAGAGTGGAGTCATTTCTCGAGAAATGACTCCACTCTGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-1215s21c1
Sequence:CCGGCAACGGATCCATGCTAATAATCTCGAGATTATTAGCATGGATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-433s21c1
Sequence:CCGGCAATATACACCGGCCACTAAACTCGAGTTTAGTGGCCGGTGTATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-1816s21c1
Sequence:CCGGTGGTATAAACCAGCGTATAAGCTCGAGCTTATACGCTGGTTTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028480
CEACAM5 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-2446s21c1
Sequence:CCGGGTACCAGTGCCTCGGAATATTCTCGAGAATATTCCGAGGCACTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028480.2-3057s21c1
Sequence:CCGGTACAGCAGAGTGGAGTCATTTCTCGAGAAATGACTCCACTCTGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-1215s21c1
Sequence:CCGGCAACGGATCCATGCTAATAATCTCGAGATTATTAGCATGGATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-433s21c1
Sequence:CCGGCAATATACACCGGCCACTAAACTCGAGTTTAGTGGCCGGTGTATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028480.2-1816s21c1
Sequence:CCGGTGGTATAAACCAGCGTATAAGCTCGAGCTTATACGCTGGTTTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks