EMAIL THIS PAGE TO A FRIEND

CEACAM6

carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)

45 Gene Product Result for
Synonyms: CD66c CEAL NCA
UniProtKB ID: P40199, Q13774, Q14920, Q53XP7
Gene ID:
Human(4680) Summary: Carcinoembryonic antigen (CEA; MIM 114890) is one of the most widely used tumor markers in serum immunoassay determinations of carcinoma. An apparent lack of absolute cancer specificity for CEA probably results in part from the presence in normal and neoplastic tissues of antigens that share antigenic determinants with the 180-kD form of CEA (Barnett et al., 1988 [PubMed 3220478]
Rat(100125369) carcinoembryonic antigen-related cell adhesion molecule 6
cow(507167) carcinoembryonic antigen-related cell adhesion molecule 6-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002483 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122461 MISSION® esiRNA esiRNA human CEACAM6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002483 Rosetta Predictions human pricing
NM_001103358 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149175 predicted 668
2 SASI_Hs01_00149176 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211574 predicted 965
2 SASI_Rn02_00211575 predicted 538
3 SASI_Rn02_00211576 predicted 1079
4 SASI_Rn02_00211577 predicted 394
5 SASI_Rn02_00211578 predicted 1016
6 SASI_Rn02_00211579 predicted 964
7 SASI_Rn02_00211580 predicted 637
8 SASI_Rn02_00211581 predicted 423
9 SASI_Rn02_00211582 predicted 644
10 SASI_Rn02_00211583 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002483
VALIDATED
CEACAM6 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002483.4-974s21c1
Sequence:CCGGGACGTTCCAGCAATCCACACACTCGAGTGTGTGGATTGCTGGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002483.4-739s21c1
Sequence:CCGGACATGACCCTCACTCTACTCACTCGAGTGAGTAGAGTGAGGGTCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002483.4-1559s21c1
Sequence:CCGGGATGATGCTGTCATTAGTATTCTCGAGAATACTAATGACAGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002483.4-770s21c1
Sequence:CCGGGAACGATGCAGGATCCTATGACTCGAGTCATAGGATCCTGCATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002483.4-1617s21c1
Sequence:CCGGATCAGATCTATCTTGTCAATCCTCGAGGATTGACAAGATAGATCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002483.4-1590s21c1
Sequence:CCGGTAGCTTCAGAGGGTAACTTAACTCGAGTTAAGTTACCCTCTGAAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-222s1c1
Sequence:CCGGCCCAGAATCGTATTGGTTACACTCGAGTGTAACCAATACGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-842s1c1
Sequence:CCGGCCTGCACAGTACTCTTGGTTTCTCGAGAAACCAAGAGTACTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-906s1c1
Sequence:CCGGCCAACATCACTGTGAATAATACTCGAGTATTATTCACAGTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-229s1c1
Sequence:CCGGTCGTATTGGTTACAGCTGGTACTCGAGTACCAGCTGTAACCAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-385s1c1
Sequence:CCGGCCAGAATGACACAGGATTCTACTCGAGTAGAATCCTGTGTCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002483
VALIDATED
CEACAM6 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002483.4-974s21c1
Sequence:CCGGGACGTTCCAGCAATCCACACACTCGAGTGTGTGGATTGCTGGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002483.4-739s21c1
Sequence:CCGGACATGACCCTCACTCTACTCACTCGAGTGAGTAGAGTGAGGGTCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002483.4-1559s21c1
Sequence:CCGGGATGATGCTGTCATTAGTATTCTCGAGAATACTAATGACAGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002483.4-770s21c1
Sequence:CCGGGAACGATGCAGGATCCTATGACTCGAGTCATAGGATCCTGCATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002483.4-1617s21c1
Sequence:CCGGATCAGATCTATCTTGTCAATCCTCGAGGATTGACAAGATAGATCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002483.4-1590s21c1
Sequence:CCGGTAGCTTCAGAGGGTAACTTAACTCGAGTTAAGTTACCCTCTGAAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-222s1c1
Sequence:CCGGCCCAGAATCGTATTGGTTACACTCGAGTGTAACCAATACGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-842s1c1
Sequence:CCGGCCTGCACAGTACTCTTGGTTTCTCGAGAAACCAAGAGTACTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-906s1c1
Sequence:CCGGCCAACATCACTGTGAATAATACTCGAGTATTATTCACAGTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-229s1c1
Sequence:CCGGTCGTATTGGTTACAGCTGGTACTCGAGTACCAGCTGTAACCAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-385s1c1
Sequence:CCGGCCAGAATGACACAGGATTCTACTCGAGTAGAATCCTGTGTCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002483
VALIDATED
CEACAM6 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002483.4-974s21c1
Sequence:CCGGGACGTTCCAGCAATCCACACACTCGAGTGTGTGGATTGCTGGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002483.4-739s21c1
Sequence:CCGGACATGACCCTCACTCTACTCACTCGAGTGAGTAGAGTGAGGGTCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002483.4-1559s21c1
Sequence:CCGGGATGATGCTGTCATTAGTATTCTCGAGAATACTAATGACAGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002483.4-770s21c1
Sequence:CCGGGAACGATGCAGGATCCTATGACTCGAGTCATAGGATCCTGCATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002483.4-1617s21c1
Sequence:CCGGATCAGATCTATCTTGTCAATCCTCGAGGATTGACAAGATAGATCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002483.4-1590s21c1
Sequence:CCGGTAGCTTCAGAGGGTAACTTAACTCGAGTTAAGTTACCCTCTGAAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-222s1c1
Sequence:CCGGCCCAGAATCGTATTGGTTACACTCGAGTGTAACCAATACGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-842s1c1
Sequence:CCGGCCTGCACAGTACTCTTGGTTTCTCGAGAAACCAAGAGTACTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-906s1c1
Sequence:CCGGCCAACATCACTGTGAATAATACTCGAGTATTATTCACAGTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-229s1c1
Sequence:CCGGTCGTATTGGTTACAGCTGGTACTCGAGTACCAGCTGTAACCAATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002483.3-385s1c1
Sequence:CCGGCCAGAATGACACAGGATTCTACTCGAGTAGAATCCTGTGTCATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks