EMAIL THIS PAGE TO A FRIEND

CEACAM7

carcinoembryonic antigen-related cell adhesion molecule 7

75 Gene Product Result for
Synonyms: CEA CGM2
Gene ID:
dog(612471) carcinoembryonic antigen-related cell adhesion molecule 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006890 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006890 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168870 predicted 340
2 SASI_Hs01_00168871 predicted 214
3 SASI_Hs01_00168873 predicted 399
4 SASI_Hs01_00168874 predicted 600
5 SASI_Hs02_00342556 predicted 461
6 SASI_Hs01_00168876 predicted 602
7 SASI_Hs01_00168877 predicted 600
8 SASI_Hs01_00168878 predicted 477
9 SASI_Hs01_00168879 predicted 214
10 SASI_Hs02_00342557 predicted 392
11 SASI_Hs01_00168872 predicted 399
12 SASI_Hs01_00168875 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006890
CEACAM7 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006890.1-1173s1c1
Sequence:CCGGGCCTCTTTAATTTGGTAAGATCTCGAGATCTTACCAAATTAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-615s1c1
Sequence:CCGGAGCGCCACAAAGAATGACATACTCGAGTATGTCATTCTTTGTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-153s1c1
Sequence:CCGGGTCCTTCTAGTAGTCCATAATCTCGAGATTATGGACTACTAGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-706s1c1
Sequence:CCGGGCTATGAGTCAGTACAAGCAACTCGAGTTGCTTGTACTGACTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-222s1c1
Sequence:CCGGCATGCCAACTATCGAATTATACTCGAGTATAATTCGATAGTTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006890
CEACAM7 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006890.1-1173s1c1
Sequence:CCGGGCCTCTTTAATTTGGTAAGATCTCGAGATCTTACCAAATTAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-615s1c1
Sequence:CCGGAGCGCCACAAAGAATGACATACTCGAGTATGTCATTCTTTGTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-153s1c1
Sequence:CCGGGTCCTTCTAGTAGTCCATAATCTCGAGATTATGGACTACTAGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-706s1c1
Sequence:CCGGGCTATGAGTCAGTACAAGCAACTCGAGTTGCTTGTACTGACTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-222s1c1
Sequence:CCGGCATGCCAACTATCGAATTATACTCGAGTATAATTCGATAGTTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006890
CEACAM7 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006890.1-1173s1c1
Sequence:CCGGGCCTCTTTAATTTGGTAAGATCTCGAGATCTTACCAAATTAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-615s1c1
Sequence:CCGGAGCGCCACAAAGAATGACATACTCGAGTATGTCATTCTTTGTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-153s1c1
Sequence:CCGGGTCCTTCTAGTAGTCCATAATCTCGAGATTATGGACTACTAGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-706s1c1
Sequence:CCGGGCTATGAGTCAGTACAAGCAACTCGAGTTGCTTGTACTGACTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006890.1-222s1c1
Sequence:CCGGCATGCCAACTATCGAATTATACTCGAGTATAATTCGATAGTTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks