EMAIL THIS PAGE TO A FRIEND

CEACAM8

carcinoembryonic antigen-related cell adhesion molecule 8

70 Gene Product Result for
Synonyms: CD66b CD67 CGM6 NCA-95
UniProtKB ID: P31997, O60399, Q16574
Gene ID:
dog(612469) carcinoembryonic antigen-related cell adhesion molecule 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001816 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109811 MISSION® esiRNA esiRNA human CEACAM8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001816 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019562 predicted 427
2 SASI_Hs01_00019563 predicted 887
3 SASI_Hs01_00019564 predicted 382
4 SASI_Hs01_00019565 predicted 347
5 SASI_Hs01_00019566 predicted 854
6 SASI_Hs01_00019567 predicted 305
7 SASI_Hs01_00019568 predicted 442
8 SASI_Hs01_00019569 predicted 345
9 SASI_Hs01_00019570 predicted 834
10 SASI_Hs01_00019571 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001816
CEACAM8 MISSION shRNA Bacterial Glycerol Stock
carcinoembryonic antigen-related cell adhesion molecule 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001816.2-2111s1c1
Sequence:CCGGGCTGACAGTAACAGCATCTTTCTCGAGAAAGATGCTGTTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001816.2-879s1c1
Sequence:CCGGCTTGGTCTGTCAATGGCACATCTCGAGATGTGCCATTGACAGACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001816.2-1026s1c1
Sequence:CCGGCTGATGCTTTAGTACAAGGAACTCGAGTTCCTTGTACTAAAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001816.2-433s1c1
Sequence:CCGGCCTACAAGTCATAAAGCTAAACTCGAGTTTAGCTTTATGACTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001816.3-1223s21c1
Sequence:CCGGTGCAATCAGCTACCATTCAAACTCGAGTTTGAATGGTAGCTGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001816.3-322s21c1
Sequence:CCGGGATGCCAACCGTCGAATTATACTCGAGTATAATTCGACGGTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001816
CEACAM8 MISSION shRNA shRNA Plasmid DNA
carcinoembryonic antigen-related cell adhesion molecule 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001816.2-2111s1c1
Sequence:CCGGGCTGACAGTAACAGCATCTTTCTCGAGAAAGATGCTGTTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001816.2-879s1c1
Sequence:CCGGCTTGGTCTGTCAATGGCACATCTCGAGATGTGCCATTGACAGACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001816.2-1026s1c1
Sequence:CCGGCTGATGCTTTAGTACAAGGAACTCGAGTTCCTTGTACTAAAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001816.2-433s1c1
Sequence:CCGGCCTACAAGTCATAAAGCTAAACTCGAGTTTAGCTTTATGACTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001816.3-1223s21c1
Sequence:CCGGTGCAATCAGCTACCATTCAAACTCGAGTTTGAATGGTAGCTGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001816.3-322s21c1
Sequence:CCGGGATGCCAACCGTCGAATTATACTCGAGTATAATTCGACGGTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001816
CEACAM8 MISSION shRNA Lentiviral Transduction Particles
carcinoembryonic antigen-related cell adhesion molecule 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001816.2-2111s1c1
Sequence:CCGGGCTGACAGTAACAGCATCTTTCTCGAGAAAGATGCTGTTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001816.2-879s1c1
Sequence:CCGGCTTGGTCTGTCAATGGCACATCTCGAGATGTGCCATTGACAGACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001816.2-1026s1c1
Sequence:CCGGCTGATGCTTTAGTACAAGGAACTCGAGTTCCTTGTACTAAAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001816.2-433s1c1
Sequence:CCGGCCTACAAGTCATAAAGCTAAACTCGAGTTTAGCTTTATGACTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001816.3-1223s21c1
Sequence:CCGGTGCAATCAGCTACCATTCAAACTCGAGTTTGAATGGTAGCTGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001816.3-322s21c1
Sequence:CCGGGATGCCAACCGTCGAATTATACTCGAGTATAATTCGACGGTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks