EMAIL THIS PAGE TO A FRIEND

CEBPA

CCAAT/enhancer binding protein (C/EBP), alpha

105 Gene Product Result for
Synonyms: C/EBP-alpha CEBP
UniProtKB ID: P49715, A7LNP2, P78319, Q05CA4
Gene ID:
Human(1050) Summary: The protein encoded by this intronless gene is a bZIP transcription factor which can bind as a homodimer to certain promoters and enhancers. It can also form heterodimers with the related proteins CEBP-beta and CEBP-gamma. The encoded protein has been shown to bind to the promoter and modulate the expression of the gene encoding leptin, a protein that plays an important role in body weight homeostasis. Also, the encoded protein can interact with CDK2 and CDK4, thereby inhibiting these kinases and causing growth arrest in cultured cells. [provided by RefSeq, Jul 2008]
Mouse(12606) CCAAT/enhancer binding protein (C/EBP), alpha
Rat(24252) CCAAT/enhancer binding protein (C/EBP), alpha
Zebrafish(140815) CCAAT/enhancer binding protein (C/EBP), alpha
chicken(427549) CCAAT/enhancer binding protein (C/EBP), alpha
cow(281677) CCAAT/enhancer binding protein (C/EBP), alpha
domestic guinea pig(101787350) CCAAT/enhancer binding protein (C/EBP), alpha
sheep(101118553) CCAAT/enhancer binding protein (C/EBP), alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500111 Anti-C/EBP-α antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4500110 Anti-C/EBP-α, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB2108101 Anti-CEBPA antibody produced in rabbit affinity isolated antibody canine, rabbit, guinea pig, pig, horse, mouse, bovine, human, rat, zebrafish
immunohistochemistry, western blot pricing
AV100908 Anti-CEBPA antibody produced in rabbit affinity isolated antibody mouse, human, guinea pig, rat, pig, bovine
western blot pricing
SAB2100396 Anti-CEBPA antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, canine, rat, chicken, horse, zebrafish, bovine, human, rabbit, pig
western blot pricing
HPA065037 Anti-CEBPA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA052734 Anti-CEBPA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA067937 Anti-CEBPA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4504116 Anti-phospho-C/EBP- (pSer193) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4503803 Anti-phospho-C/EBP-α (pSer21) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301228 Anti-phospho-C/EBP-α (pSer21) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4504117 Anti-phospho-C/EBP-α (pThr226) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301346 Anti-phospho-C/EBP-α (pThr230) antibody produced in rabbit affinity isolated antibody human
western blot pricing
C8119 Monoclonal Anti-phospho C/EBPα (pThr222/226) antibody produced in mouse ~1 mg/mL, clone 9G11, purified immunoglobulin, buffered aqueous solution human, canine
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004364 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218961 MISSION® esiRNA esiRNA targeting human CEBPA human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004364 Rosetta Predictions human pricing
NM_012524 Rosetta Predictions rat pricing
NM_007678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058601 predicted 1243
2 SASI_Hs01_00058602 predicted 1334
3 SASI_Hs01_00058603 predicted 1382
4 SASI_Hs01_00058604 predicted 1332
5 SASI_Hs01_00058605 predicted 1033
6 SASI_Hs01_00058606 predicted 1246
7 SASI_Hs02_00337432 predicted 1407
8 SASI_Hs01_00058607 predicted 1407
9 SASI_Hs01_00058608 predicted 1356
10 SASI_Hs01_00058609 predicted 1245
11 SASI_Hs01_00058610 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034372 predicted 1162
2 SASI_Rn01_00034373 predicted 1066
3 SASI_Rn01_00034374 predicted 1311
4 SASI_Rn01_00034376 predicted 1072
5 SASI_Rn02_00259598 predicted 357
6 SASI_Rn01_00034377 predicted 1028
7 SASI_Rn02_00259599 predicted 354
8 SASI_Rn01_00034378 predicted 1110
9 SASI_Rn01_00034379 predicted 1075
10 SASI_Rn01_00034380 predicted 819
11 SASI_Rn01_00034375 predicted 1068
12 SASI_Rn01_00034381 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177674 predicted 1459
2 SASI_Mm01_00177675 predicted 1486
3 SASI_Mm01_00177676 predicted 1489
4 SASI_Mm01_00177677 predicted 1069
5 SASI_Mm01_00177678 predicted 1158
6 SASI_Mm02_00312205 predicted 1155
7 SASI_Mm01_00177679 predicted 1257
8 SASI_Mm02_00312206 predicted 1461
9 SASI_Mm01_00177681 predicted 1108
10 SASI_Mm01_00177682 predicted 1041
11 SASI_Mm01_00177680 predicted 1052
12 SASI_Mm01_00177683 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007678
VALIDATED
CEBPA MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-916s1c1
Sequence:CCGGCAACGCAACGTGGAGACGCAACTCGAGTTGCGTCTCCACGTTGCGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007678.1-898s1c1
Sequence:CCGGAGCCGAGATAAAGCCAAACAACTCGAGTTGTTTGGCTTTATCTCGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-171s1c1
Sequence:CCGGGCACGAGACGTCTATAGACATCTCGAGATGTCTATAGACGTCTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-630s1c1
Sequence:CCGGCCAGACCACCATGCACCTACACTCGAGTGTAGGTGCATGGTGGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-462s1c1
Sequence:CCGGGCCGCTGGTGATCAAACAAGACTCGAGTCTTGTTTGATCACCAGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007678.3-292s21c1
Sequence:CCGGTGCGAGCACGAGACGTCTATACTCGAGTATAGACGTCTCGTGCTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007678.3-1113s21c1
Sequence:CCGGGGAACAGCTGAGCCGTGAACTCTCGAGAGTTCACGGCTCAGCTGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007678.3-963s21c1
Sequence:CCGGGGACAAGAACAGCAACGAGTACTCGAGTACTCGTTGCTGTTCTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007678.3-1024s21c1
Sequence:CCGGAGCCGAGATAAAGCCAAACAACTCGAGTTGTTTGGCTTTATCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007678.3-1302s21c1
Sequence:CCGGCAAGCCAGGACTAGGAGATTCCTCGAGGAATCTCCTAGTCCTGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007678
VALIDATED
CEBPA MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-916s1c1
Sequence:CCGGCAACGCAACGTGGAGACGCAACTCGAGTTGCGTCTCCACGTTGCGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007678.1-898s1c1
Sequence:CCGGAGCCGAGATAAAGCCAAACAACTCGAGTTGTTTGGCTTTATCTCGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-171s1c1
Sequence:CCGGGCACGAGACGTCTATAGACATCTCGAGATGTCTATAGACGTCTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-630s1c1
Sequence:CCGGCCAGACCACCATGCACCTACACTCGAGTGTAGGTGCATGGTGGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-462s1c1
Sequence:CCGGGCCGCTGGTGATCAAACAAGACTCGAGTCTTGTTTGATCACCAGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007678.3-292s21c1
Sequence:CCGGTGCGAGCACGAGACGTCTATACTCGAGTATAGACGTCTCGTGCTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007678.3-1113s21c1
Sequence:CCGGGGAACAGCTGAGCCGTGAACTCTCGAGAGTTCACGGCTCAGCTGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007678.3-963s21c1
Sequence:CCGGGGACAAGAACAGCAACGAGTACTCGAGTACTCGTTGCTGTTCTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007678.3-1024s21c1
Sequence:CCGGAGCCGAGATAAAGCCAAACAACTCGAGTTGTTTGGCTTTATCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007678.3-1302s21c1
Sequence:CCGGCAAGCCAGGACTAGGAGATTCCTCGAGGAATCTCCTAGTCCTGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007678
VALIDATED
CEBPA MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-916s1c1
Sequence:CCGGCAACGCAACGTGGAGACGCAACTCGAGTTGCGTCTCCACGTTGCGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007678.1-898s1c1
Sequence:CCGGAGCCGAGATAAAGCCAAACAACTCGAGTTGTTTGGCTTTATCTCGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-171s1c1
Sequence:CCGGGCACGAGACGTCTATAGACATCTCGAGATGTCTATAGACGTCTCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-630s1c1
Sequence:CCGGCCAGACCACCATGCACCTACACTCGAGTGTAGGTGCATGGTGGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007678.1-462s1c1
Sequence:CCGGGCCGCTGGTGATCAAACAAGACTCGAGTCTTGTTTGATCACCAGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007678.3-292s21c1
Sequence:CCGGTGCGAGCACGAGACGTCTATACTCGAGTATAGACGTCTCGTGCTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007678.3-1113s21c1
Sequence:CCGGGGAACAGCTGAGCCGTGAACTCTCGAGAGTTCACGGCTCAGCTGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007678.3-963s21c1
Sequence:CCGGGGACAAGAACAGCAACGAGTACTCGAGTACTCGTTGCTGTTCTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007678.3-1024s21c1
Sequence:CCGGAGCCGAGATAAAGCCAAACAACTCGAGTTGTTTGGCTTTATCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007678.3-1302s21c1
Sequence:CCGGCAAGCCAGGACTAGGAGATTCCTCGAGGAATCTCCTAGTCCTGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004364
CEBPA MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004364.2-822s1c1
Sequence:CCGGCAAGAAGTCGGTGGACAAGAACTCGAGTTCTTGTCCACCGACTTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004364.2-171s1c1
Sequence:CCGGGCACGAGACGTCCATCGACATCTCGAGATGTCGATGGACGTCTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004364.2-942s1c1
Sequence:CCGGGCTGGAGCTGACCAGTGACAACTCGAGTTGTCACTGGTCAGCTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004364.2-1335s1c1
Sequence:CCGGGCAACTCTAGTATTTAGGATACTCGAGTATCCTAAATACTAGAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004364.3-727s21c1
Sequence:CCGGTGCAGTTCCAGATCGCGCACTCTCGAGAGTGCGCGATCTGGAACTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004364.3-1441s21c1
Sequence:CCGGCCCGGCAACTCTAGTATTTAGCTCGAGCTAAATACTAGAGTTGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004364.3-1521s21c1
Sequence:CCGGGCAAATCGTGCCTTGTCATTTCTCGAGAAATGACAAGGCACGATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004364.3-946s21c1
Sequence:CCGGACAAGAACAGCAACGAGTACCCTCGAGGGTACTCGTTGCTGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004364.3-283s21c1
Sequence:CCGGACGAGACGTCCATCGACATCACTCGAGTGATGTCGATGGACGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004364
CEBPA MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004364.2-822s1c1
Sequence:CCGGCAAGAAGTCGGTGGACAAGAACTCGAGTTCTTGTCCACCGACTTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004364.2-171s1c1
Sequence:CCGGGCACGAGACGTCCATCGACATCTCGAGATGTCGATGGACGTCTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004364.2-942s1c1
Sequence:CCGGGCTGGAGCTGACCAGTGACAACTCGAGTTGTCACTGGTCAGCTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004364.2-1335s1c1
Sequence:CCGGGCAACTCTAGTATTTAGGATACTCGAGTATCCTAAATACTAGAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004364.3-727s21c1
Sequence:CCGGTGCAGTTCCAGATCGCGCACTCTCGAGAGTGCGCGATCTGGAACTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004364.3-1441s21c1
Sequence:CCGGCCCGGCAACTCTAGTATTTAGCTCGAGCTAAATACTAGAGTTGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004364.3-1521s21c1
Sequence:CCGGGCAAATCGTGCCTTGTCATTTCTCGAGAAATGACAAGGCACGATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004364.3-946s21c1
Sequence:CCGGACAAGAACAGCAACGAGTACCCTCGAGGGTACTCGTTGCTGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004364.3-283s21c1
Sequence:CCGGACGAGACGTCCATCGACATCACTCGAGTGATGTCGATGGACGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004364
CEBPA MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004364.2-822s1c1
Sequence:CCGGCAAGAAGTCGGTGGACAAGAACTCGAGTTCTTGTCCACCGACTTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004364.2-171s1c1
Sequence:CCGGGCACGAGACGTCCATCGACATCTCGAGATGTCGATGGACGTCTCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004364.2-942s1c1
Sequence:CCGGGCTGGAGCTGACCAGTGACAACTCGAGTTGTCACTGGTCAGCTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004364.2-1335s1c1
Sequence:CCGGGCAACTCTAGTATTTAGGATACTCGAGTATCCTAAATACTAGAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004364.3-727s21c1
Sequence:CCGGTGCAGTTCCAGATCGCGCACTCTCGAGAGTGCGCGATCTGGAACTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004364.3-1441s21c1
Sequence:CCGGCCCGGCAACTCTAGTATTTAGCTCGAGCTAAATACTAGAGTTGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004364.3-1521s21c1
Sequence:CCGGGCAAATCGTGCCTTGTCATTTCTCGAGAAATGACAAGGCACGATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004364.3-946s21c1
Sequence:CCGGACAAGAACAGCAACGAGTACCCTCGAGGGTACTCGTTGCTGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004364.3-283s21c1
Sequence:CCGGACGAGACGTCCATCGACATCACTCGAGTGATGTCGATGGACGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)