EMAIL THIS PAGE TO A FRIEND

CEBPB

CCAAT/enhancer binding protein (C/EBP), beta

88 Gene Product Result for
Synonyms: C/EBP-beta CRP2 IL6DBP LAP NF-IL6 TCF5
UniProtKB ID: P17676, A8K671, Q96IH2, Q9H4Z5
Gene ID:
Human(1051) Summary: The protein encoded by this intronless gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related proteins CEBP-alpha, CEBP-delta, and CEBP-gamma. The encoded protein is important in the regulation of genes involved in immune and inflammatory responses and has been shown to bind to the IL-1 response element in the IL-6 gene, as well as to regulatory regions of several acute-phase and cytokine genes. In addition, the encoded protein can bind the promoter and upstream element and stimulate the expression of the collagen type I gene. [provided by RefSeq, Jul 2008]
Mouse(12608) CCAAT/enhancer binding protein (C/EBP), beta
Rat(24253) CCAAT/enhancer binding protein (C/EBP), beta
domestic guinea pig(100735178) CCAAT/enhancer binding protein (C/EBP), beta
naked mole-rat(101698039) CCAAT/enhancer binding protein (C/EBP), beta
sheep(443277) CCAAT/enhancer binding protein (C/EBP), beta
Zebrafish(140814) CCAAT/enhancer binding protein (C/EBP), beta
domestic cat(100144613) CCAAT/enhancer binding protein (C/EBP), beta
cow(338319) CCAAT/enhancer binding protein (C/EBP), beta
chicken(396185) CCAAT/enhancer binding protein (C/EBP), beta
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500112 Anti-C/EBP-β antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
C1371 Anti-CEBPB (267-279) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C1496 Anti-CEBPB (291-305) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405605 Anti-CEBPB antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV31259 Anti-CEBPB antibody produced in rabbit affinity isolated antibody bovine, canine, rabbit, human, guinea pig
western blot pricing
SAB2100397 Anti-CEBPB antibody produced in rabbit affinity isolated antibody bovine, pig, rabbit, human
western blot pricing
HPA061355 Anti-CEBPB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA062267 Anti-CEBPB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4500113 Anti-CEBPB, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4503804 Anti-phospho-C/EBP-β (pThr235/188) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1105211 Anti-phospho-CEBPB (pThr235) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2702381 Monoclonal Anti-C/EBP beta antibody produced in mouse clone 21A1, affinity isolated antibody human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB4200196 Monoclonal Anti-C/EBPβ antibody produced in rat ~1.0 mg/mL, clone 7H5, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5300496 Monoclonal Anti-CEBPB antibody produced in mouse clone 3H9, ascites fluid human
ELISA, flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005194 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005194 Rosetta Predictions human pricing
NM_024125 Rosetta Predictions rat pricing
NM_009883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339146 predicted 1463
2 SASI_Hs02_00339147 predicted 1465
3 SASI_Hs01_00236022 predicted 400
4 SASI_Hs01_00236027 predicted 1539
5 SASI_Hs01_00236028 predicted 1543
6 SASI_Hs01_00236023 predicted 810
7 SASI_Hs01_00236029 predicted 1546
8 SASI_Hs02_00339148 predicted 982
9 SASI_Hs02_00339149 predicted 1143
10 SASI_Hs02_00339150 predicted 1479
11 SASI_Hs01_00236021 predicted 544
12 SASI_Hs01_00236024 predicted 1782
13 SASI_Hs01_00236025 predicted 1642
14 SASI_Hs01_00236026 predicted 1563
15 SASI_Hs01_00236030 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042542 predicted 1316
2 SASI_Rn01_00042544 predicted 1517
3 SASI_Rn01_00042545 predicted 1571
4 SASI_Rn01_00042546 predicted 1503
5 SASI_Rn01_00042547 predicted 1763
6 SASI_Rn01_00042548 predicted 503
7 SASI_Rn02_00263841 predicted 1597
8 SASI_Rn01_00042549 predicted 1596
9 SASI_Rn01_00042550 predicted 1512
10 SASI_Rn01_00042551 predicted 1770
11 SASI_Rn01_00042543 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187563 predicted 1178
2 SASI_Mm01_00187565 predicted 1436
3 SASI_Mm02_00317364 predicted 1274
4 SASI_Mm01_00187570 predicted 626
5 SASI_Mm02_00317365 predicted 1273
6 SASI_Mm02_00317366 predicted 1180
7 SASI_Mm01_00187571 predicted 756
8 SASI_Mm02_00317367 predicted 1439
9 SASI_Mm02_00317368 predicted 1269
10 SASI_Mm02_00317369 predicted 404
11 SASI_Mm01_00187562 predicted 1234
12 SASI_Mm01_00187564 predicted 1407
13 SASI_Mm01_00187566 predicted 159
14 SASI_Mm01_00187567 predicted 1268
15 SASI_Mm01_00187568 predicted 1392
16 SASI_Mm01_00187569 predicted 1249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005194
VALIDATED
CEBPB MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), beta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-998s21c1
Sequence:CCGGACAAGCACAGCGACGAGTACACTCGAGTGTACTCGTCGCTGTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-1170s21c1
Sequence:CCGGCACCCTGCGGAACTTGTTCAACTCGAGTTGAACAAGTTCCGCAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-411s21c1
Sequence:CCGGCATCGACTTCAGCCCGTACCTCTCGAGAGGTACGGGCTGAAGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-261s21c1
Sequence:CCGGATCCATGGAAGTGGCCAACTTCTCGAGAAGTTGGCCACTTCCATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-281s21c1
Sequence:CCGGTCTACTACGAGGCGGACTGCTCTCGAGAGCAGTCCGCCTCGTAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-270s21c1
Sequence:CCGGAGTGGCCAACTTCTACTACGACTCGAGTCGTAGTAGAAGTTGGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-1065s21c1
Sequence:CCGGCAAGGCCAAGATGCGCAACCTCTCGAGAGGTTGCGCATCTTGGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005194.2-1448s1c1
Sequence:CCGGCCCGTGGTGTTATTTAAAGAACTCGAGTTCTTTAAATAACACCACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005194.2-540s1c1
Sequence:CCGGCGACTTCCTCTCCGACCTCTTCTCGAGAAGAGGTCGGAGAGGAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005194.2-1002s1c1
Sequence:CCGGGCACAGCGACGAGTACAAGATCTCGAGATCTTGTACTCGTCGCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005194.2-250s1c1
Sequence:CCGGCCTGCCTTTAAATCCATGGAACTCGAGTTCCATGGATTTAAAGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005194
VALIDATED
CEBPB MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), beta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-998s21c1
Sequence:CCGGACAAGCACAGCGACGAGTACACTCGAGTGTACTCGTCGCTGTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-1170s21c1
Sequence:CCGGCACCCTGCGGAACTTGTTCAACTCGAGTTGAACAAGTTCCGCAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-411s21c1
Sequence:CCGGCATCGACTTCAGCCCGTACCTCTCGAGAGGTACGGGCTGAAGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-261s21c1
Sequence:CCGGATCCATGGAAGTGGCCAACTTCTCGAGAAGTTGGCCACTTCCATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-281s21c1
Sequence:CCGGTCTACTACGAGGCGGACTGCTCTCGAGAGCAGTCCGCCTCGTAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-270s21c1
Sequence:CCGGAGTGGCCAACTTCTACTACGACTCGAGTCGTAGTAGAAGTTGGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-1065s21c1
Sequence:CCGGCAAGGCCAAGATGCGCAACCTCTCGAGAGGTTGCGCATCTTGGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005194.2-1448s1c1
Sequence:CCGGCCCGTGGTGTTATTTAAAGAACTCGAGTTCTTTAAATAACACCACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005194.2-540s1c1
Sequence:CCGGCGACTTCCTCTCCGACCTCTTCTCGAGAAGAGGTCGGAGAGGAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005194.2-1002s1c1
Sequence:CCGGGCACAGCGACGAGTACAAGATCTCGAGATCTTGTACTCGTCGCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005194.2-250s1c1
Sequence:CCGGCCTGCCTTTAAATCCATGGAACTCGAGTTCCATGGATTTAAAGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005194
VALIDATED
CEBPB MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), beta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-998s21c1
Sequence:CCGGACAAGCACAGCGACGAGTACACTCGAGTGTACTCGTCGCTGTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-1170s21c1
Sequence:CCGGCACCCTGCGGAACTTGTTCAACTCGAGTTGAACAAGTTCCGCAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-411s21c1
Sequence:CCGGCATCGACTTCAGCCCGTACCTCTCGAGAGGTACGGGCTGAAGTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-261s21c1
Sequence:CCGGATCCATGGAAGTGGCCAACTTCTCGAGAAGTTGGCCACTTCCATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-281s21c1
Sequence:CCGGTCTACTACGAGGCGGACTGCTCTCGAGAGCAGTCCGCCTCGTAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-270s21c1
Sequence:CCGGAGTGGCCAACTTCTACTACGACTCGAGTCGTAGTAGAAGTTGGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005194.2-1065s21c1
Sequence:CCGGCAAGGCCAAGATGCGCAACCTCTCGAGAGGTTGCGCATCTTGGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005194.2-1448s1c1
Sequence:CCGGCCCGTGGTGTTATTTAAAGAACTCGAGTTCTTTAAATAACACCACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005194.2-540s1c1
Sequence:CCGGCGACTTCCTCTCCGACCTCTTCTCGAGAAGAGGTCGGAGAGGAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005194.2-1002s1c1
Sequence:CCGGGCACAGCGACGAGTACAAGATCTCGAGATCTTGTACTCGTCGCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005194.2-250s1c1
Sequence:CCGGCCTGCCTTTAAATCCATGGAACTCGAGTTCCATGGATTTAAAGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009883
VALIDATED
CEBPB MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), beta
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009883.3-1241s21c1
Sequence:CCGGCTGACGCAACACACGTGTAACCTCGAGGTTACACGTGTGTTGCGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009883.3-935s21c1
Sequence:CCGGCACCCTGCGGAACTTGTTCAACTCGAGTTGAACAAGTTCCGCAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-845s21c1
Sequence:CCGGCAACCTGGAGACGCAGCACAACTCGAGTTGTGCTGCGTCTCCAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-167s21c1
Sequence:CCGGACCCATGGAAGTGGCCAACTTCTCGAGAAGTTGGCCACTTCCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-184s21c1
Sequence:CCGGACTTCTACTACGAGCCCGACTCTCGAGAGTCGGGCTCGTAGTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-176s21c1
Sequence:CCGGAGTGGCCAACTTCTACTACGACTCGAGTCGTAGTAGAAGTTGGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-158s21c1
Sequence:CCGGCGCCTTTAGACCCATGGAAGTCTCGAGACTTCCATGGGTCTAAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009883.1-1264s1c1
Sequence:CCGGGCCCTGAGTAATCACCTTAAACTCGAGTTTAAGGTGATTACTCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-156s1c1
Sequence:CCGGGCCGCCTTTAGACCCATGGAACTCGAGTTCCATGGGTCTAAAGGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-938s1c1
Sequence:CCGGCCTGCGGAACTTGTTCAAGCACTCGAGTGCTTGAACAAGTTCCGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-371s1c1
Sequence:CCGGCGACCTCTTCGCCGACGACTACTCGAGTAGTCGTCGGCGAAGAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-845s1c1
Sequence:CCGGCAACCTGGAGACGCAGCACAACTCGAGTTGTGCTGCGTCTCCAGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009883
VALIDATED
CEBPB MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), beta
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009883.3-1241s21c1
Sequence:CCGGCTGACGCAACACACGTGTAACCTCGAGGTTACACGTGTGTTGCGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009883.3-935s21c1
Sequence:CCGGCACCCTGCGGAACTTGTTCAACTCGAGTTGAACAAGTTCCGCAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-845s21c1
Sequence:CCGGCAACCTGGAGACGCAGCACAACTCGAGTTGTGCTGCGTCTCCAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-167s21c1
Sequence:CCGGACCCATGGAAGTGGCCAACTTCTCGAGAAGTTGGCCACTTCCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-184s21c1
Sequence:CCGGACTTCTACTACGAGCCCGACTCTCGAGAGTCGGGCTCGTAGTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-176s21c1
Sequence:CCGGAGTGGCCAACTTCTACTACGACTCGAGTCGTAGTAGAAGTTGGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-158s21c1
Sequence:CCGGCGCCTTTAGACCCATGGAAGTCTCGAGACTTCCATGGGTCTAAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009883.1-1264s1c1
Sequence:CCGGGCCCTGAGTAATCACCTTAAACTCGAGTTTAAGGTGATTACTCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-156s1c1
Sequence:CCGGGCCGCCTTTAGACCCATGGAACTCGAGTTCCATGGGTCTAAAGGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-938s1c1
Sequence:CCGGCCTGCGGAACTTGTTCAAGCACTCGAGTGCTTGAACAAGTTCCGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-371s1c1
Sequence:CCGGCGACCTCTTCGCCGACGACTACTCGAGTAGTCGTCGGCGAAGAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-845s1c1
Sequence:CCGGCAACCTGGAGACGCAGCACAACTCGAGTTGTGCTGCGTCTCCAGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009883
VALIDATED
CEBPB MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), beta
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009883.3-1241s21c1
Sequence:CCGGCTGACGCAACACACGTGTAACCTCGAGGTTACACGTGTGTTGCGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009883.3-935s21c1
Sequence:CCGGCACCCTGCGGAACTTGTTCAACTCGAGTTGAACAAGTTCCGCAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-845s21c1
Sequence:CCGGCAACCTGGAGACGCAGCACAACTCGAGTTGTGCTGCGTCTCCAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-167s21c1
Sequence:CCGGACCCATGGAAGTGGCCAACTTCTCGAGAAGTTGGCCACTTCCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-184s21c1
Sequence:CCGGACTTCTACTACGAGCCCGACTCTCGAGAGTCGGGCTCGTAGTAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-176s21c1
Sequence:CCGGAGTGGCCAACTTCTACTACGACTCGAGTCGTAGTAGAAGTTGGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009883.3-158s21c1
Sequence:CCGGCGCCTTTAGACCCATGGAAGTCTCGAGACTTCCATGGGTCTAAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009883.1-1264s1c1
Sequence:CCGGGCCCTGAGTAATCACCTTAAACTCGAGTTTAAGGTGATTACTCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-156s1c1
Sequence:CCGGGCCGCCTTTAGACCCATGGAACTCGAGTTCCATGGGTCTAAAGGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-938s1c1
Sequence:CCGGCCTGCGGAACTTGTTCAAGCACTCGAGTGCTTGAACAAGTTCCGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-371s1c1
Sequence:CCGGCGACCTCTTCGCCGACGACTACTCGAGTAGTCGTCGGCGAAGAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009883.1-845s1c1
Sequence:CCGGCAACCTGGAGACGCAGCACAACTCGAGTTGTGCTGCGTCTCCAGGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)