EMAIL THIS PAGE TO A FRIEND

CEBPD

CCAAT/enhancer binding protein (C/EBP), delta

70 Gene Product Result for
Synonyms: C/EBP-delta CELF CRP3 NF-IL6-beta
UniProtKB ID: P49716, Q14937, Q2M2X9
Gene ID:
Human(1052) Summary: The protein encoded by this intronless gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-alpha. The encoded protein is important in the regulation of genes involved in immune and inflammatory responses, and may be involved in the regulation of genes associated with activation and/or differentiation of macrophages. The cytogenetic location of this locus has been reported as both 8p11 and 8q11. [provided by RefSeq, Sep 2010]
Mouse(12609) CCAAT/enhancer binding protein (C/EBP), delta
Rat(25695) CCAAT/enhancer binding protein (C/EBP), delta
Zebrafish(140817) CCAAT/enhancer binding protein (C/EBP), delta
dog(606783) CCAAT/enhancer-binding protein delta-like
Horse(100050784) CCAAT/enhancer binding protein (C/EBP), delta
cow(281678) CCAAT/enhancer binding protein (C/EBP), delta
sheep(101104916) CCAAT/enhancer binding protein (C/EBP), delta
naked mole-rat(101723047) CCAAT/enhancer binding protein (C/EBP), delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005195 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU227251 MISSION® esiRNA esiRNA targeting human CEBPD human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005195 Rosetta Predictions human pricing
NM_013154 Rosetta Predictions rat pricing
NM_007679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180747 predicted 776
2 SASI_Hs01_00180748 predicted 777
3 SASI_Hs01_00180756 predicted 784
4 SASI_Hs01_00180749 predicted 871
5 SASI_Hs01_00180750 predicted 875
6 SASI_Hs01_00180751 predicted 863
7 SASI_Hs01_00180752 predicted 865
8 SASI_Hs01_00180753 predicted 815
9 SASI_Hs01_00180754 predicted 777
10 SASI_Hs01_00180755 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086971 predicted 276
2 SASI_Rn01_00086972 predicted 902
3 SASI_Rn02_00260962 predicted 206
4 SASI_Rn01_00086973 predicted 378
5 SASI_Rn01_00086974 predicted 560
6 SASI_Rn02_00260963 predicted 208
7 SASI_Rn01_00086976 predicted 247
8 SASI_Rn01_00086977 predicted 503
9 SASI_Rn02_00260964 predicted 771
10 SASI_Rn01_00086978 predicted 892
11 SASI_Rn01_00086975 predicted 895
12 SASI_Rn01_00086979 predicted 445
13 SASI_Rn01_00086980 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093692 predicted 1108
2 SASI_Mm01_00093693 predicted 1335
3 SASI_Mm01_00093694 predicted 702
4 SASI_Mm01_00093695 predicted 389
5 SASI_Mm01_00093696 predicted 1055
6 SASI_Mm01_00093697 predicted 1308
7 SASI_Mm01_00093698 predicted 1278
8 SASI_Mm01_00093699 predicted 1179
9 SASI_Mm01_00093700 predicted 1336
10 SASI_Mm02_00312207 predicted 979
11 SASI_Mm01_00093701 predicted 1151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005195
CEBPD MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), delta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005195.2-1069s1c1
Sequence:CCGGCGAGAGAAGCTAAACGTGTTTCTCGAGAAACACGTTTAGCTTCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-335s1c1
Sequence:CCGGGCCGACCTCTTCAACAGCAATCTCGAGATTGCTGTTGAAGAGGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-271s1c1
Sequence:CCGGCAGCGCCTACATCGACTCCATCTCGAGATGGAGTCGATGTAGGCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-877s1c1
Sequence:CCGGCGGGACAGCAGACTGCCGGTACTCGAGTACCGGCAGTCTGCTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-763s1c1
Sequence:CCGGGCTGTCGGCTGAGAACGAGAACTCGAGTTCTCGTTCTCAGCCGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005195.3-728s21c1
Sequence:CCGGTGAGAACGAGAAGCTGCACCACTCGAGTGGTGCAGCTTCTCGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005195.3-971s21c1
Sequence:CCGGTTGGGACATAGGAGCGCAAAGCTCGAGCTTTGCGCTCCTATGTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005195.3-299s21c1
Sequence:CCGGCTTCAACAGCAATCACAAGGCCTCGAGGCCTTGTGATTGCTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005195.3-1099s21c1
Sequence:CCGGTTGATGCAGCTAAGGTACATTCTCGAGAATGTACCTTAGCTGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005195
CEBPD MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), delta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005195.2-1069s1c1
Sequence:CCGGCGAGAGAAGCTAAACGTGTTTCTCGAGAAACACGTTTAGCTTCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-335s1c1
Sequence:CCGGGCCGACCTCTTCAACAGCAATCTCGAGATTGCTGTTGAAGAGGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-271s1c1
Sequence:CCGGCAGCGCCTACATCGACTCCATCTCGAGATGGAGTCGATGTAGGCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-877s1c1
Sequence:CCGGCGGGACAGCAGACTGCCGGTACTCGAGTACCGGCAGTCTGCTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-763s1c1
Sequence:CCGGGCTGTCGGCTGAGAACGAGAACTCGAGTTCTCGTTCTCAGCCGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005195.3-728s21c1
Sequence:CCGGTGAGAACGAGAAGCTGCACCACTCGAGTGGTGCAGCTTCTCGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005195.3-971s21c1
Sequence:CCGGTTGGGACATAGGAGCGCAAAGCTCGAGCTTTGCGCTCCTATGTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005195.3-299s21c1
Sequence:CCGGCTTCAACAGCAATCACAAGGCCTCGAGGCCTTGTGATTGCTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005195.3-1099s21c1
Sequence:CCGGTTGATGCAGCTAAGGTACATTCTCGAGAATGTACCTTAGCTGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005195
CEBPD MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), delta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005195.2-1069s1c1
Sequence:CCGGCGAGAGAAGCTAAACGTGTTTCTCGAGAAACACGTTTAGCTTCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-335s1c1
Sequence:CCGGGCCGACCTCTTCAACAGCAATCTCGAGATTGCTGTTGAAGAGGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-271s1c1
Sequence:CCGGCAGCGCCTACATCGACTCCATCTCGAGATGGAGTCGATGTAGGCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-877s1c1
Sequence:CCGGCGGGACAGCAGACTGCCGGTACTCGAGTACCGGCAGTCTGCTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005195.2-763s1c1
Sequence:CCGGGCTGTCGGCTGAGAACGAGAACTCGAGTTCTCGTTCTCAGCCGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005195.3-728s21c1
Sequence:CCGGTGAGAACGAGAAGCTGCACCACTCGAGTGGTGCAGCTTCTCGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005195.3-971s21c1
Sequence:CCGGTTGGGACATAGGAGCGCAAAGCTCGAGCTTTGCGCTCCTATGTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005195.3-299s21c1
Sequence:CCGGCTTCAACAGCAATCACAAGGCCTCGAGGCCTTGTGATTGCTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005195.3-1099s21c1
Sequence:CCGGTTGATGCAGCTAAGGTACATTCTCGAGAATGTACCTTAGCTGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007679
CEBPD MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), delta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-276s1c1
Sequence:CCGGCGAACTCTTCGCCGACCTCTTCTCGAGAAGAGGTCGGCGAAGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-464s1c1
Sequence:CCGGGCGCGCAGACAGTGGTGAGCTCTCGAGAGCTCACCACTGTCTGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-735s1c1
Sequence:CCGGGCTGCATCAGCGCGTGGAGCACTCGAGTGCTCCACGCGCTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-114s1c1
Sequence:CCGGCGAGCCAGGCAGGGTGGACAACTCGAGTTGTCCACCCTGCCTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-222s1c1
Sequence:CCGGCAGCGCCTACATTGACTCCATCTCGAGATGGAGTCAATGTAGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-260s21c1
Sequence:CCGGTAGAGCTGTGCCACGACGAACCTCGAGGTTCGTCGTGGCACAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-715s21c1
Sequence:CCGGTTGTCGGCCGAGAACGAGAAGCTCGAGCTTCTCGTTCTCGGCCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007679.4-1338s21c1
Sequence:CCGGACGGGAAAGCATGACTAATTCCTCGAGGAATTAGTCATGCTTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-293s21c1
Sequence:CCGGTCTTCAACAGCAACCACAAAGCTCGAGCTTTGTGGTTGCTGTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-215s21c1
Sequence:CCGGTCGACTTCAGCGCCTACATTGCTCGAGCAATGTAGGCGCTGAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007679
CEBPD MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), delta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-276s1c1
Sequence:CCGGCGAACTCTTCGCCGACCTCTTCTCGAGAAGAGGTCGGCGAAGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-464s1c1
Sequence:CCGGGCGCGCAGACAGTGGTGAGCTCTCGAGAGCTCACCACTGTCTGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-735s1c1
Sequence:CCGGGCTGCATCAGCGCGTGGAGCACTCGAGTGCTCCACGCGCTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-114s1c1
Sequence:CCGGCGAGCCAGGCAGGGTGGACAACTCGAGTTGTCCACCCTGCCTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-222s1c1
Sequence:CCGGCAGCGCCTACATTGACTCCATCTCGAGATGGAGTCAATGTAGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-260s21c1
Sequence:CCGGTAGAGCTGTGCCACGACGAACCTCGAGGTTCGTCGTGGCACAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-715s21c1
Sequence:CCGGTTGTCGGCCGAGAACGAGAAGCTCGAGCTTCTCGTTCTCGGCCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007679.4-1338s21c1
Sequence:CCGGACGGGAAAGCATGACTAATTCCTCGAGGAATTAGTCATGCTTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-293s21c1
Sequence:CCGGTCTTCAACAGCAACCACAAAGCTCGAGCTTTGTGGTTGCTGTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-215s21c1
Sequence:CCGGTCGACTTCAGCGCCTACATTGCTCGAGCAATGTAGGCGCTGAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007679
CEBPD MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), delta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-276s1c1
Sequence:CCGGCGAACTCTTCGCCGACCTCTTCTCGAGAAGAGGTCGGCGAAGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-464s1c1
Sequence:CCGGGCGCGCAGACAGTGGTGAGCTCTCGAGAGCTCACCACTGTCTGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-735s1c1
Sequence:CCGGGCTGCATCAGCGCGTGGAGCACTCGAGTGCTCCACGCGCTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-114s1c1
Sequence:CCGGCGAGCCAGGCAGGGTGGACAACTCGAGTTGTCCACCCTGCCTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007679.2-222s1c1
Sequence:CCGGCAGCGCCTACATTGACTCCATCTCGAGATGGAGTCAATGTAGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-260s21c1
Sequence:CCGGTAGAGCTGTGCCACGACGAACCTCGAGGTTCGTCGTGGCACAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-715s21c1
Sequence:CCGGTTGTCGGCCGAGAACGAGAAGCTCGAGCTTCTCGTTCTCGGCCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007679.4-1338s21c1
Sequence:CCGGACGGGAAAGCATGACTAATTCCTCGAGGAATTAGTCATGCTTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-293s21c1
Sequence:CCGGTCTTCAACAGCAACCACAAAGCTCGAGCTTTGTGGTTGCTGTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007679.4-215s21c1
Sequence:CCGGTCGACTTCAGCGCCTACATTGCTCGAGCAATGTAGGCGCTGAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks