EMAIL THIS PAGE TO A FRIEND

CEBPE

CCAAT/enhancer binding protein (C/EBP), epsilon

52 Gene Product Result for
Synonyms: C/EBP-epsilon CRP1
UniProtKB ID: Q15744, Q15745, Q8IYI2, Q99803
Gene ID:
Human(1053) Summary: The protein encoded by this gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-delta. The encoded protein may be essential for terminal differentiation and functional maturation of committed granulocyte progenitor cells. Mutations in this gene have been associated with Specific Granule Deficiency, a rare congenital disorder. Multiple variants of this gene have been described, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Mouse(110794) CCAAT/enhancer binding protein (C/EBP), epsilon
Rat(25410) CCAAT/enhancer binding protein (C/EBP), epsilon
domestic guinea pig(100729561) CCAAT/enhancer binding protein (C/EBP), epsilon
naked mole-rat(101718295) CCAAT/enhancer binding protein (C/EBP), epsilon
sheep(101122954) CCAAT/enhancer binding protein (C/EBP), epsilon
domestic cat(101093864) CCAAT/enhancer binding protein (C/EBP), epsilon
cow(534346) CCAAT/enhancer binding protein (C/EBP), epsilon
Horse(100052512) CCAAT/enhancer binding protein (C/EBP), epsilon
dog(490607) CCAAT/enhancer binding protein (C/EBP), epsilon
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001805 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022611 MISSION® esiRNA esiRNA human CEBPE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001805 Rosetta Predictions human pricing
NM_017095 Rosetta Predictions rat pricing
NM_207131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053855 predicted 844
2 SASI_Hs02_00332580 predicted 430
3 SASI_Hs01_00053856 predicted 757
4 SASI_Hs01_00053858 predicted 956
5 SASI_Hs01_00053859 predicted 448
6 SASI_Hs01_00053860 predicted 444
7 SASI_Hs01_00053861 predicted 932
8 SASI_Hs01_00053862 predicted 430
9 SASI_Hs02_00332581 predicted 424
10 SASI_Hs01_00053864 predicted 270
11 SASI_Hs01_00053857 predicted 758
12 SASI_Hs01_00053863 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042283 predicted 197
2 SASI_Rn01_00042284 predicted 211
3 SASI_Rn01_00042285 predicted 213
4 SASI_Rn01_00042286 predicted 213
5 SASI_Rn01_00042287 predicted 271
6 SASI_Rn01_00042289 predicted 250
7 SASI_Rn01_00042291 predicted 293
8 SASI_Rn02_00261309 predicted 272
9 SASI_Rn02_00261310 predicted 272
10 SASI_Rn02_00261311 predicted 253
11 SASI_Rn01_00042282 predicted 298
12 SASI_Rn01_00042288 predicted 584
13 SASI_Rn01_00042290 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351880 predicted 397
2 SASI_Mm01_00142089 predicted 793
3 SASI_Mm01_00142090 predicted 369
4 SASI_Mm01_00142091 predicted 883
5 SASI_Mm01_00142092 predicted 330
6 SASI_Mm01_00142093 predicted 473
7 SASI_Mm01_00142094 predicted 905
8 SASI_Mm01_00142095 predicted 478
9 SASI_Mm01_00142096 predicted 952
10 SASI_Mm01_00142097 predicted 973
11 SASI_Mm01_00142098 predicted 843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207131
CEBPE MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), epsilon
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000451881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207131.1-638s21c1
Sequence:CCGGTGCAGTACCAAGTGGCACACTCTCGAGAGTGTGCCACTTGGTACTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-843s1c1
Sequence:CCGGGCGACGTGAACGTAACAACATCTCGAGATGTTGTTACGTTCACGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-806s1c1
Sequence:CCGGAGAAGGCAGTGAACAAAGATACTCGAGTATCTTTGTTCACTGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-481s1c1
Sequence:CCGGGCCTATCCCTCACACACATTTCTCGAGAAATGTGTGTGAGGGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-923s1c1
Sequence:CCGGTCCTGGAGTACATGGCTGAAACTCGAGTTTCAGCCATGTACTCCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-369s1c1
Sequence:CCGGACAGCTACTTTCTGACCTCTTCTCGAGAAGAGGTCAGAAAGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207131.1-333s21c1
Sequence:CCGGCATCGACCTCTCCGCCTACATCTCGAGATGTAGGCGGAGAGGTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207131
CEBPE MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), epsilon
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000451881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207131.1-638s21c1
Sequence:CCGGTGCAGTACCAAGTGGCACACTCTCGAGAGTGTGCCACTTGGTACTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-843s1c1
Sequence:CCGGGCGACGTGAACGTAACAACATCTCGAGATGTTGTTACGTTCACGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-806s1c1
Sequence:CCGGAGAAGGCAGTGAACAAAGATACTCGAGTATCTTTGTTCACTGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-481s1c1
Sequence:CCGGGCCTATCCCTCACACACATTTCTCGAGAAATGTGTGTGAGGGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-923s1c1
Sequence:CCGGTCCTGGAGTACATGGCTGAAACTCGAGTTTCAGCCATGTACTCCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-369s1c1
Sequence:CCGGACAGCTACTTTCTGACCTCTTCTCGAGAAGAGGTCAGAAAGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207131.1-333s21c1
Sequence:CCGGCATCGACCTCTCCGCCTACATCTCGAGATGTAGGCGGAGAGGTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207131
CEBPE MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), epsilon
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000451881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207131.1-638s21c1
Sequence:CCGGTGCAGTACCAAGTGGCACACTCTCGAGAGTGTGCCACTTGGTACTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-843s1c1
Sequence:CCGGGCGACGTGAACGTAACAACATCTCGAGATGTTGTTACGTTCACGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-806s1c1
Sequence:CCGGAGAAGGCAGTGAACAAAGATACTCGAGTATCTTTGTTCACTGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-481s1c1
Sequence:CCGGGCCTATCCCTCACACACATTTCTCGAGAAATGTGTGTGAGGGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-923s1c1
Sequence:CCGGTCCTGGAGTACATGGCTGAAACTCGAGTTTCAGCCATGTACTCCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207131.1-369s1c1
Sequence:CCGGACAGCTACTTTCTGACCTCTTCTCGAGAAGAGGTCAGAAAGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207131.1-333s21c1
Sequence:CCGGCATCGACCTCTCCGCCTACATCTCGAGATGTAGGCGGAGAGGTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001805
VALIDATED
CEBPE MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), epsilon
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001805.2-599s21c1
Sequence:CCGGAGTACCAAGTGGCACACTGTGCTCGAGCACAGTGTGCCACTTGGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001805.2-843s21c1
Sequence:CCGGCAAGGCCAAGAGGCGCATTCTCTCGAGAGAATGCGCCTCTTGGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001805.2-882s21c1
Sequence:CCGGGCTGGAGTACATGGCAGAGAACTCGAGTTCTCTGCCATGTACTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001805.2-1098s1c1
Sequence:CCGGGAACCCTGAGACATAGACCATCTCGAGATGGTCTATGTCTCAGGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001805.2-434s1c1
Sequence:CCGGCCTTTGCCTACCCTCCACATACTCGAGTATGTGGAGGGTAGGCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001805.2-336s1c1
Sequence:CCGGCTCCGATCTCTTTGCCGTGAACTCGAGTTCACGGCAAAGAGATCGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001805.2-769s1c1
Sequence:CCGGGCAGTGAACAAAGATAGCCTTCTCGAGAAGGCTATCTTTGTTCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001805.2-954s1c1
Sequence:CCGGCCGCAACCTCTTCCGCCAGATCTCGAGATCTGGCGGAAGAGGTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001805
VALIDATED
CEBPE MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), epsilon
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001805.2-599s21c1
Sequence:CCGGAGTACCAAGTGGCACACTGTGCTCGAGCACAGTGTGCCACTTGGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001805.2-843s21c1
Sequence:CCGGCAAGGCCAAGAGGCGCATTCTCTCGAGAGAATGCGCCTCTTGGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001805.2-882s21c1
Sequence:CCGGGCTGGAGTACATGGCAGAGAACTCGAGTTCTCTGCCATGTACTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001805.2-1098s1c1
Sequence:CCGGGAACCCTGAGACATAGACCATCTCGAGATGGTCTATGTCTCAGGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001805.2-434s1c1
Sequence:CCGGCCTTTGCCTACCCTCCACATACTCGAGTATGTGGAGGGTAGGCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001805.2-336s1c1
Sequence:CCGGCTCCGATCTCTTTGCCGTGAACTCGAGTTCACGGCAAAGAGATCGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001805.2-769s1c1
Sequence:CCGGGCAGTGAACAAAGATAGCCTTCTCGAGAAGGCTATCTTTGTTCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001805.2-954s1c1
Sequence:CCGGCCGCAACCTCTTCCGCCAGATCTCGAGATCTGGCGGAAGAGGTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001805
VALIDATED
CEBPE MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), epsilon
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001805.2-599s21c1
Sequence:CCGGAGTACCAAGTGGCACACTGTGCTCGAGCACAGTGTGCCACTTGGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001805.2-843s21c1
Sequence:CCGGCAAGGCCAAGAGGCGCATTCTCTCGAGAGAATGCGCCTCTTGGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001805.2-882s21c1
Sequence:CCGGGCTGGAGTACATGGCAGAGAACTCGAGTTCTCTGCCATGTACTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001805.2-1098s1c1
Sequence:CCGGGAACCCTGAGACATAGACCATCTCGAGATGGTCTATGTCTCAGGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001805.2-434s1c1
Sequence:CCGGCCTTTGCCTACCCTCCACATACTCGAGTATGTGGAGGGTAGGCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001805.2-336s1c1
Sequence:CCGGCTCCGATCTCTTTGCCGTGAACTCGAGTTCACGGCAAAGAGATCGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001805.2-769s1c1
Sequence:CCGGGCAGTGAACAAAGATAGCCTTCTCGAGAAGGCTATCTTTGTTCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001805.2-954s1c1
Sequence:CCGGCCGCAACCTCTTCCGCCAGATCTCGAGATCTGGCGGAAGAGGTTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)