EMAIL THIS PAGE TO A FRIEND

CEBPG

CCAAT/enhancer binding protein (C/EBP), gamma

94 Gene Product Result for
Synonyms: GPE1BP IG/EBP-1
UniProtKB ID: P53567, B2R946, Q5U052
Gene ID:
Human(1054) Summary: The C/EBP family of transcription factors regulates viral and cellular CCAAT/enhancer element-mediated transcription. C/EBP proteins contain the bZIP region, which is characterized by two motifs in the C-terminal half of the protein: a basic region involved in DNA binding and a leucine zipper motif involved in dimerization. The C/EBP family consist of several related proteins, C/EBP alpha, C/EBP beta, C/EBP gamma, and C/EBP delta, that form homodimers and that form heterodimers with each other. CCAAT/enhancer binding protein gamma may cooperate with Fos to bind PRE-I enhancer elements. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(12611) CCAAT/enhancer binding protein (C/EBP), gamma
Rat(25301) CCAAT/enhancer binding protein (C/EBP), gamma
Zebrafish(140816) CCAAT/enhancer binding protein (C/EBP), gamma
cow(617530) CCAAT/enhancer binding protein (C/EBP), gamma
domestic cat(101090819) CCAAT/enhancer binding protein (C/EBP), gamma
dog(100686458) CCAAT/enhancer binding protein (C/EBP), gamma
chicken(395800) CCAAT/enhancer binding protein (C/EBP), gamma
sheep(101110612) CCAAT/enhancer binding protein (C/EBP), gamma
naked mole-rat(101725970) CCAAT/enhancer binding protein (C/EBP), gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001806 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001806 Rosetta Predictions human pricing
NM_012831 Rosetta Predictions rat pricing
NM_009884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179825 predicted 1226
2 SASI_Hs01_00179826 predicted 704
3 SASI_Hs01_00179827 predicted 471
4 SASI_Hs01_00179829 predicted 675
5 SASI_Hs01_00179830 predicted 551
6 SASI_Hs02_00332582 predicted 664
7 SASI_Hs01_00179831 predicted 322
8 SASI_Hs01_00179832 predicted 875
9 SASI_Hs01_00179833 predicted 462
10 SASI_Hs01_00179834 predicted 441
11 SASI_Hs01_00179828 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260284 predicted 1132
2 SASI_Rn02_00260285 predicted 835
3 SASI_Rn02_00260286 predicted 1093
4 SASI_Rn02_00260287 predicted 1021
5 SASI_Rn02_00260288 predicted 583
6 SASI_Rn02_00260289 predicted 664
7 SASI_Rn02_00260290 predicted 855
8 SASI_Rn02_00260291 predicted 849
9 SASI_Rn02_00260292 predicted 1062
10 SASI_Rn02_00260293 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037093 predicted 455
2 SASI_Mm01_00037094 predicted 496
3 SASI_Mm01_00037095 predicted 470
4 SASI_Mm01_00037096 predicted 320
5 SASI_Mm01_00037097 predicted 689
6 SASI_Mm01_00037098 predicted 303
7 SASI_Mm01_00037099 predicted 536
8 SASI_Mm01_00037100 predicted 876
9 SASI_Mm01_00037101 predicted 542
10 SASI_Mm01_00037102 predicted 885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001806
VALIDATED
CEBPG MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001806.x-721s1c1
Sequence:CCGGTGGCGACAATGCAGGACAGTACTCGAGTACTGTCCTGCATTGTCGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001806.x-620s1c1
Sequence:CCGGCTGACCAAGGAATTAAGTGTACTCGAGTACACTTAATTCCTTGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001806.x-744s1c1
Sequence:CCGGCCTCACCCTTTCCAGACTTTACTCGAGTAAAGTCTGGAAAGGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001806.x-487s1c1
Sequence:CCGGGCAACGCCGAGAGAGGAACAACTCGAGTTGTTCCTCTCTCGGCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001806.x-647s1c1
Sequence:CCGGGATTTGTTTCTTGAGCATGCACTCGAGTGCATGCTCAAGAAACAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-487s21c1
Sequence:CCGGGCAACGCCGAGAGAGGAACAACTCGAGTTGTTCCTCTCTCGGCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-647s21c1
Sequence:CCGGGATTTGTTTCTTGAGCATGCACTCGAGTGCATGCTCAAGAAACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-906s21c1
Sequence:CCGGTTAGCCTTGTAATTCGAATATCTCGAGATATTCGAATTACAAGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-678s21c1
Sequence:CCGGCAGACAACGTACAGTCCATTACTCGAGTAATGGACTGTACGTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-465s21c1
Sequence:CCGGATCGAAACAGTGACGAGTATCCTCGAGGATACTCGTCACTGTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001806
VALIDATED
CEBPG MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001806.x-721s1c1
Sequence:CCGGTGGCGACAATGCAGGACAGTACTCGAGTACTGTCCTGCATTGTCGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001806.x-620s1c1
Sequence:CCGGCTGACCAAGGAATTAAGTGTACTCGAGTACACTTAATTCCTTGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001806.x-744s1c1
Sequence:CCGGCCTCACCCTTTCCAGACTTTACTCGAGTAAAGTCTGGAAAGGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001806.x-487s1c1
Sequence:CCGGGCAACGCCGAGAGAGGAACAACTCGAGTTGTTCCTCTCTCGGCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001806.x-647s1c1
Sequence:CCGGGATTTGTTTCTTGAGCATGCACTCGAGTGCATGCTCAAGAAACAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-487s21c1
Sequence:CCGGGCAACGCCGAGAGAGGAACAACTCGAGTTGTTCCTCTCTCGGCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-647s21c1
Sequence:CCGGGATTTGTTTCTTGAGCATGCACTCGAGTGCATGCTCAAGAAACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-906s21c1
Sequence:CCGGTTAGCCTTGTAATTCGAATATCTCGAGATATTCGAATTACAAGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-678s21c1
Sequence:CCGGCAGACAACGTACAGTCCATTACTCGAGTAATGGACTGTACGTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-465s21c1
Sequence:CCGGATCGAAACAGTGACGAGTATCCTCGAGGATACTCGTCACTGTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001806
VALIDATED
CEBPG MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001806.x-721s1c1
Sequence:CCGGTGGCGACAATGCAGGACAGTACTCGAGTACTGTCCTGCATTGTCGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001806.x-620s1c1
Sequence:CCGGCTGACCAAGGAATTAAGTGTACTCGAGTACACTTAATTCCTTGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001806.x-744s1c1
Sequence:CCGGCCTCACCCTTTCCAGACTTTACTCGAGTAAAGTCTGGAAAGGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001806.x-487s1c1
Sequence:CCGGGCAACGCCGAGAGAGGAACAACTCGAGTTGTTCCTCTCTCGGCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001806.x-647s1c1
Sequence:CCGGGATTTGTTTCTTGAGCATGCACTCGAGTGCATGCTCAAGAAACAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-487s21c1
Sequence:CCGGGCAACGCCGAGAGAGGAACAACTCGAGTTGTTCCTCTCTCGGCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-647s21c1
Sequence:CCGGGATTTGTTTCTTGAGCATGCACTCGAGTGCATGCTCAAGAAACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-906s21c1
Sequence:CCGGTTAGCCTTGTAATTCGAATATCTCGAGATATTCGAATTACAAGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-678s21c1
Sequence:CCGGCAGACAACGTACAGTCCATTACTCGAGTAATGGACTGTACGTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001806.2-465s21c1
Sequence:CCGGATCGAAACAGTGACGAGTATCCTCGAGGATACTCGTCACTGTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009884
VALIDATED
CEBPG MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), gamma
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009884.2-1299s1c1
Sequence:CCGGCCTAATAATTTGGCCCTATTTCTCGAGAAATAGGGCCAAATTATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009884.2-435s1c1
Sequence:CCGGCGGAACAATATGGCGGTGAAACTCGAGTTTCACCGCCATATTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009884.2-363s1c1
Sequence:CCGGCCTCCAAGCAAGCAAAGCAAACTCGAGTTTGCTTTGCTTGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009884.2-519s1c1
Sequence:CCGGGAAGAGAATGAACGGTTGGAACTCGAGTTCCAACCGTTCATTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009884.2-637s1c1
Sequence:CCGGCGGAAACTACAGCGACAAATTCTCGAGAATTTGTCGCTGTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-461s21c1
Sequence:CCGGGGATCGGAATAGTGACGAATACTCGAGTATTCGTCACTATTCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-551s21c1
Sequence:CCGGAGATACACTGCAAAGAGTAAACTCGAGTTTACTCTTTGCAGTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-614s21c1
Sequence:CCGGGTTGCTGACAAAGGAATTAAGCTCGAGCTTAATTCCTTTGTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-2619s21c1
Sequence:CCGGACAAGGACTCACCCATATAATCTCGAGATTATATGGGTGAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-329s21c1
Sequence:CCGGTGGAATAAGTGTCATTCATACCTCGAGGTATGAATGACACTTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009884
VALIDATED
CEBPG MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), gamma
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009884.2-1299s1c1
Sequence:CCGGCCTAATAATTTGGCCCTATTTCTCGAGAAATAGGGCCAAATTATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009884.2-435s1c1
Sequence:CCGGCGGAACAATATGGCGGTGAAACTCGAGTTTCACCGCCATATTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009884.2-363s1c1
Sequence:CCGGCCTCCAAGCAAGCAAAGCAAACTCGAGTTTGCTTTGCTTGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009884.2-519s1c1
Sequence:CCGGGAAGAGAATGAACGGTTGGAACTCGAGTTCCAACCGTTCATTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009884.2-637s1c1
Sequence:CCGGCGGAAACTACAGCGACAAATTCTCGAGAATTTGTCGCTGTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-461s21c1
Sequence:CCGGGGATCGGAATAGTGACGAATACTCGAGTATTCGTCACTATTCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-551s21c1
Sequence:CCGGAGATACACTGCAAAGAGTAAACTCGAGTTTACTCTTTGCAGTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-614s21c1
Sequence:CCGGGTTGCTGACAAAGGAATTAAGCTCGAGCTTAATTCCTTTGTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-2619s21c1
Sequence:CCGGACAAGGACTCACCCATATAATCTCGAGATTATATGGGTGAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-329s21c1
Sequence:CCGGTGGAATAAGTGTCATTCATACCTCGAGGTATGAATGACACTTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009884
VALIDATED
CEBPG MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), gamma
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009884.2-1299s1c1
Sequence:CCGGCCTAATAATTTGGCCCTATTTCTCGAGAAATAGGGCCAAATTATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009884.2-435s1c1
Sequence:CCGGCGGAACAATATGGCGGTGAAACTCGAGTTTCACCGCCATATTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009884.2-363s1c1
Sequence:CCGGCCTCCAAGCAAGCAAAGCAAACTCGAGTTTGCTTTGCTTGCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009884.2-519s1c1
Sequence:CCGGGAAGAGAATGAACGGTTGGAACTCGAGTTCCAACCGTTCATTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009884.2-637s1c1
Sequence:CCGGCGGAAACTACAGCGACAAATTCTCGAGAATTTGTCGCTGTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-461s21c1
Sequence:CCGGGGATCGGAATAGTGACGAATACTCGAGTATTCGTCACTATTCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-551s21c1
Sequence:CCGGAGATACACTGCAAAGAGTAAACTCGAGTTTACTCTTTGCAGTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-614s21c1
Sequence:CCGGGTTGCTGACAAAGGAATTAAGCTCGAGCTTAATTCCTTTGTCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-2619s21c1
Sequence:CCGGACAAGGACTCACCCATATAATCTCGAGATTATATGGGTGAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009884.3-329s21c1
Sequence:CCGGTGGAATAAGTGTCATTCATACCTCGAGGTATGAATGACACTTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks