EMAIL THIS PAGE TO A FRIEND

CEBPZ

CCAAT/enhancer binding protein (C/EBP), zeta

65 Gene Product Result for
Synonyms: CBF CBF2 HSP-CBF NOC1
UniProtKB ID: Q03701, Q8NE75
Gene ID:
Mouse(12607) CCAAT/enhancer binding protein zeta
Rat(362686) CCAAT/enhancer binding protein zeta
domestic guinea pig(100736036) CCAAT/enhancer binding protein (C/EBP), zeta
naked mole-rat(101725601) CCAAT/enhancer binding protein (C/EBP), zeta
sheep(101121334) CCAAT/enhancer binding protein (C/EBP), zeta
Domestic Rabbit(100340898) CCAAT/enhancer binding protein (C/EBP), zeta
Zebrafish(550440) CCAAT/enhancer binding protein (C/EBP), zeta
chicken(421474) CCAAT/enhancer binding protein (C/EBP), zeta
domestic cat(101082486) CCAAT/enhancer binding protein (C/EBP), zeta
cow(507575) CCAAT/enhancer binding protein (C/EBP), zeta
dog(483035) CCAAT/enhancer binding protein (C/EBP), zeta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005760 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_009882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005760 Rosetta Predictions human pricing
NM_001108701 Rosetta Predictions rat pricing
NM_001024806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014844 predicted 873
2 SASI_Hs01_00014845 predicted 655
3 SASI_Hs01_00014846 predicted 1073
4 SASI_Hs01_00014847 predicted 2694
5 SASI_Hs01_00014849 predicted 1875
6 SASI_Hs01_00014850 predicted 1004
7 SASI_Hs01_00014851 predicted 1810
8 SASI_Hs01_00014852 predicted 2782
9 SASI_Hs02_00340233 predicted 2655
10 SASI_Hs02_00340234 predicted 892
11 SASI_Hs01_00014848 predicted 1709
12 SASI_Hs01_00014853 predicted 2517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241225 predicted 1293
2 SASI_Rn02_00241226 predicted 2248
3 SASI_Rn02_00241227 predicted 1613
4 SASI_Rn02_00241228 predicted 973
5 SASI_Rn02_00241229 predicted 1690
6 SASI_Rn02_00241230 predicted 2374
7 SASI_Rn02_00241231 predicted 3138
8 SASI_Rn02_00241232 predicted 740
9 SASI_Rn02_00241233 predicted 2188
10 SASI_Rn02_00241234 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160992 predicted 1021
2 SASI_Mm02_00287717 predicted 1558
3 SASI_Mm01_00160993 predicted 1661
4 SASI_Mm01_00160994 predicted 2726
5 SASI_Mm01_00160995 predicted 1398
6 SASI_Mm01_00160996 predicted 1504
7 SASI_Mm01_00160997 predicted 3168
8 SASI_Mm01_00160998 predicted 1088
9 SASI_Mm02_00287718 predicted 1005
10 SASI_Mm01_00161000 predicted 689
11 SASI_Mm01_00160999 predicted 906
12 SASI_Mm01_00161001 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005760
VALIDATED
CEBPZ MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), zeta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-179s21c1
Sequence:CCGGGCACCAAGCAAGATTACCTTACTCGAGTAAGGTAATCTTGCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-299s21c1
Sequence:CCGGATCTTAATTTGGCGAAGTATACTCGAGTATACTTCGCCAAATTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-1306s21c1
Sequence:CCGGAGGCTACTCTTCCGCTCAAATCTCGAGATTTGAGCGGAAGAGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-2299s21c1
Sequence:CCGGGATCGATTTGTATACCGAAATCTCGAGATTTCGGTATACAAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-775s21c1
Sequence:CCGGGCAGCCATGATTCTTCTTATTCTCGAGAATAAGAAGAATCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005760.2-1318s1c1
Sequence:CCGGCGCTCAAATATCAGCTCCAAACTCGAGTTTGGAGCTGATATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005760.2-179s1c1
Sequence:CCGGGCACCAAGCAAGATTACCTTACTCGAGTAAGGTAATCTTGCTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005760.2-775s1c1
Sequence:CCGGGCAGCCATGATTCTTCTTATTCTCGAGAATAAGAAGAATCATGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005760.2-1828s1c1
Sequence:CCGGCCATTTATATGTGGAGCTTTACTCGAGTAAAGCTCCACATATAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005760.2-1641s1c1
Sequence:CCGGGCAGACAATATCGGATCGATACTCGAGTATCGATCCGATATTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005760
VALIDATED
CEBPZ MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), zeta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-179s21c1
Sequence:CCGGGCACCAAGCAAGATTACCTTACTCGAGTAAGGTAATCTTGCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-299s21c1
Sequence:CCGGATCTTAATTTGGCGAAGTATACTCGAGTATACTTCGCCAAATTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-1306s21c1
Sequence:CCGGAGGCTACTCTTCCGCTCAAATCTCGAGATTTGAGCGGAAGAGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-2299s21c1
Sequence:CCGGGATCGATTTGTATACCGAAATCTCGAGATTTCGGTATACAAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-775s21c1
Sequence:CCGGGCAGCCATGATTCTTCTTATTCTCGAGAATAAGAAGAATCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005760.2-1318s1c1
Sequence:CCGGCGCTCAAATATCAGCTCCAAACTCGAGTTTGGAGCTGATATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005760.2-179s1c1
Sequence:CCGGGCACCAAGCAAGATTACCTTACTCGAGTAAGGTAATCTTGCTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005760.2-775s1c1
Sequence:CCGGGCAGCCATGATTCTTCTTATTCTCGAGAATAAGAAGAATCATGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005760.2-1828s1c1
Sequence:CCGGCCATTTATATGTGGAGCTTTACTCGAGTAAAGCTCCACATATAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005760.2-1641s1c1
Sequence:CCGGGCAGACAATATCGGATCGATACTCGAGTATCGATCCGATATTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005760
VALIDATED
CEBPZ MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), zeta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-179s21c1
Sequence:CCGGGCACCAAGCAAGATTACCTTACTCGAGTAAGGTAATCTTGCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-299s21c1
Sequence:CCGGATCTTAATTTGGCGAAGTATACTCGAGTATACTTCGCCAAATTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-1306s21c1
Sequence:CCGGAGGCTACTCTTCCGCTCAAATCTCGAGATTTGAGCGGAAGAGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-2299s21c1
Sequence:CCGGGATCGATTTGTATACCGAAATCTCGAGATTTCGGTATACAAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005760.2-775s21c1
Sequence:CCGGGCAGCCATGATTCTTCTTATTCTCGAGAATAAGAAGAATCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005760.2-1318s1c1
Sequence:CCGGCGCTCAAATATCAGCTCCAAACTCGAGTTTGGAGCTGATATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005760.2-179s1c1
Sequence:CCGGGCACCAAGCAAGATTACCTTACTCGAGTAAGGTAATCTTGCTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005760.2-775s1c1
Sequence:CCGGGCAGCCATGATTCTTCTTATTCTCGAGAATAAGAAGAATCATGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005760.2-1828s1c1
Sequence:CCGGCCATTTATATGTGGAGCTTTACTCGAGTAAAGCTCCACATATAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005760.2-1641s1c1
Sequence:CCGGGCAGACAATATCGGATCGATACTCGAGTATCGATCCGATATTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024806
VALIDATED
CEBPZ MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), zeta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-597s21c1
Sequence:CCGGTGGAGTACAGCGGTGAGTATTCTCGAGAATACTCACCGCTGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-1316s21c1
Sequence:CCGGAGGCTACTCTTCCGCTCAAATCTCGAGATTTGAGCGGAAGAGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024806.2-3812s21c1
Sequence:CCGGAGCTGTTCTCATCTAAGTAATCTCGAGATTACTTAGATGAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-2312s21c1
Sequence:CCGGGATCGATTTGTGTACCGAAATCTCGAGATTTCGGTACACAAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-1026s21c1
Sequence:CCGGGACTGATACTGTGGTATTATGCTCGAGCATAATACCACAGTATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024806
VALIDATED
CEBPZ MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), zeta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-597s21c1
Sequence:CCGGTGGAGTACAGCGGTGAGTATTCTCGAGAATACTCACCGCTGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-1316s21c1
Sequence:CCGGAGGCTACTCTTCCGCTCAAATCTCGAGATTTGAGCGGAAGAGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024806.2-3812s21c1
Sequence:CCGGAGCTGTTCTCATCTAAGTAATCTCGAGATTACTTAGATGAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-2312s21c1
Sequence:CCGGGATCGATTTGTGTACCGAAATCTCGAGATTTCGGTACACAAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-1026s21c1
Sequence:CCGGGACTGATACTGTGGTATTATGCTCGAGCATAATACCACAGTATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024806
VALIDATED
CEBPZ MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), zeta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-597s21c1
Sequence:CCGGTGGAGTACAGCGGTGAGTATTCTCGAGAATACTCACCGCTGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-1316s21c1
Sequence:CCGGAGGCTACTCTTCCGCTCAAATCTCGAGATTTGAGCGGAAGAGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024806.2-3812s21c1
Sequence:CCGGAGCTGTTCTCATCTAAGTAATCTCGAGATTACTTAGATGAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-2312s21c1
Sequence:CCGGGATCGATTTGTGTACCGAAATCTCGAGATTTCGGTACACAAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024806.2-1026s21c1
Sequence:CCGGGACTGATACTGTGGTATTATGCTCGAGCATAATACCACAGTATCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009882
VALIDATED
CEBPZ MISSION shRNA Bacterial Glycerol Stock
CCAAT/enhancer binding protein (C/EBP), zeta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-155s1c1
Sequence:CCGGCGGAGGCACAAAGCAAGATTACTCGAGTAATCTTGCTTTGTGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-1155s1c1
Sequence:CCGGGCTCTTCTTGTGCAGGTGATACTCGAGTATCACCTGCACAAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-471s1c1
Sequence:CCGGCCCGTCTCCAAAGCAAAGAAACTCGAGTTTCTTTGCTTTGGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-653s1c1
Sequence:CCGGGCACGAAGTCAGCTTATTCAACTCGAGTTGAATAAGCTGACTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-501s1c1
Sequence:CCGGCCCGATGTGTTTGAATTTCTACTCGAGTAGAAATTCAAACACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009882
VALIDATED
CEBPZ MISSION shRNA shRNA Plasmid DNA
CCAAT/enhancer binding protein (C/EBP), zeta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-155s1c1
Sequence:CCGGCGGAGGCACAAAGCAAGATTACTCGAGTAATCTTGCTTTGTGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-1155s1c1
Sequence:CCGGGCTCTTCTTGTGCAGGTGATACTCGAGTATCACCTGCACAAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-471s1c1
Sequence:CCGGCCCGTCTCCAAAGCAAAGAAACTCGAGTTTCTTTGCTTTGGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-653s1c1
Sequence:CCGGGCACGAAGTCAGCTTATTCAACTCGAGTTGAATAAGCTGACTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-501s1c1
Sequence:CCGGCCCGATGTGTTTGAATTTCTACTCGAGTAGAAATTCAAACACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009882
VALIDATED
CEBPZ MISSION shRNA Lentiviral Transduction Particles
CCAAT/enhancer binding protein (C/EBP), zeta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-155s1c1
Sequence:CCGGCGGAGGCACAAAGCAAGATTACTCGAGTAATCTTGCTTTGTGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-1155s1c1
Sequence:CCGGGCTCTTCTTGTGCAGGTGATACTCGAGTATCACCTGCACAAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-471s1c1
Sequence:CCGGCCCGTCTCCAAAGCAAAGAAACTCGAGTTTCTTTGCTTTGGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-653s1c1
Sequence:CCGGGCACGAAGTCAGCTTATTCAACTCGAGTTGAATAAGCTGACTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009882.1-501s1c1
Sequence:CCGGCCCGATGTGTTTGAATTTCTACTCGAGTAGAAATTCAAACACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks