EMAIL THIS PAGE TO A FRIEND

CECR1

cat eye syndrome chromosome region, candidate 1

Synonyms: ADA2 ADGF IDGFL
UniProtKB ID: Q9NZK5, A8K9H4, Q6ICF1, Q86UB6, Q8NCJ2, Q96K41
Gene ID:
Human(51816) Summary: This gene encodes a member of a subfamily of the adenosine deaminase protein family. The encoded protein may act as a growth factor and have adenosine deaminase activity. It may be responsible for some of the phenotypic features associated with cat eye syndrome. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
chicken(418160) cat eye syndrome chromosome region, candidate 1
cow(617805) cat eye syndrome chromosome region, candidate 1
domestic cat(101094858) cat eye syndrome chromosome region, candidate 1
dog(484249) cat eye syndrome chromosome region, candidate 1
sheep(101121925) cat eye syndrome chromosome region, candidate 1
naked mole-rat(101704143) cat eye syndrome chromosome region, candidate 1
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017424 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078101 MISSION® esiRNA esiRNA human CECR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017424 Rosetta Predictions human pricing
NM_177405 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096464 predicted 1530
2 SASI_Hs01_00096465 predicted 1309
3 SASI_Hs01_00096466 predicted 1351
4 SASI_Hs02_00349994 predicted 1559
5 SASI_Hs02_00349995 predicted 1523
6 SASI_Hs01_00096469 predicted 1284
7 SASI_Hs01_00096470 predicted 1549
8 SASI_Hs01_00096472 predicted 1248
9 SASI_Hs02_00349996 predicted 1330
10 SASI_Hs02_00349997 predicted 1445
11 SASI_Hs01_00096467 predicted 1558
12 SASI_Hs01_00096468 predicted 1357
13 SASI_Hs01_00096471 predicted 1644
14 SASI_Hs01_00096473 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039755 predicted 679
2 SASI_Hs01_00039756 predicted 451
3 SASI_Hs01_00039757 predicted 484
4 SASI_Hs02_00369307 predicted 708
5 SASI_Hs02_00369308 predicted 660
6 SASI_Hs01_00039760 predicted 420
7 SASI_Hs01_00039761 predicted 690
8 SASI_Hs01_00039763 predicted 391
9 SASI_Hs02_00369309 predicted 466
10 SASI_Hs02_00369310 predicted 591
11 SASI_Hs01_00039758 predicted 699
12 SASI_Hs01_00039759 predicted 499
13 SASI_Hs01_00039762 predicted 780
14 SASI_Hs01_00039764 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017424
VALIDATED
CECR1 MISSION shRNA Bacterial Glycerol Stock
cat eye syndrome chromosome region, candidate 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017424.2-1539s1c1
Sequence:CCGGCCAGCTATGTTTGGTGCCAAACTCGAGTTTGGCACCAAACATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_017424.2-1392s1c1
Sequence:CCGGGTCAGGACTTACTCCTGGAAACTCGAGTTTCCAGGAGTAAGTCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_017424.2-1112s1c1
Sequence:CCGGCATCGCAGAATCCATCCGAATCTCGAGATTCGGATGGATTCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_017424.2-478s1c1
Sequence:CCGGCCAAGCATCTCATTGAGAGAACTCGAGTTCTCTCAATGAGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017424.2-1053s1c1
Sequence:CCGGCCTGAGTTTATTGGAATCAAACTCGAGTTTGATTCCAATAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017424.2-697s21c1
Sequence:CCGGGGATTCTGCTGGAGGATTATCCTCGAGGATAATCCTCCAGCAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017424.2-814s21c1
Sequence:CCGGATGTTGTCTGGTCGAAATTTGCTCGAGCAAATTTCGACCAGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017424.2-555s21c1
Sequence:CCGGGACATTGGCATCGTGACTATGCTCGAGCATAGTCACGATGCCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017424
VALIDATED
CECR1 MISSION shRNA shRNA Plasmid DNA
cat eye syndrome chromosome region, candidate 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017424.2-1539s1c1
Sequence:CCGGCCAGCTATGTTTGGTGCCAAACTCGAGTTTGGCACCAAACATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_017424.2-1392s1c1
Sequence:CCGGGTCAGGACTTACTCCTGGAAACTCGAGTTTCCAGGAGTAAGTCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_017424.2-1112s1c1
Sequence:CCGGCATCGCAGAATCCATCCGAATCTCGAGATTCGGATGGATTCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_017424.2-478s1c1
Sequence:CCGGCCAAGCATCTCATTGAGAGAACTCGAGTTCTCTCAATGAGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017424.2-1053s1c1
Sequence:CCGGCCTGAGTTTATTGGAATCAAACTCGAGTTTGATTCCAATAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017424.2-697s21c1
Sequence:CCGGGGATTCTGCTGGAGGATTATCCTCGAGGATAATCCTCCAGCAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017424.2-814s21c1
Sequence:CCGGATGTTGTCTGGTCGAAATTTGCTCGAGCAAATTTCGACCAGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017424.2-555s21c1
Sequence:CCGGGACATTGGCATCGTGACTATGCTCGAGCATAGTCACGATGCCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017424
VALIDATED
CECR1 MISSION shRNA Lentiviral Transduction Particles
cat eye syndrome chromosome region, candidate 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017424.2-1539s1c1
Sequence:CCGGCCAGCTATGTTTGGTGCCAAACTCGAGTTTGGCACCAAACATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_017424.2-1392s1c1
Sequence:CCGGGTCAGGACTTACTCCTGGAAACTCGAGTTTCCAGGAGTAAGTCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_017424.2-1112s1c1
Sequence:CCGGCATCGCAGAATCCATCCGAATCTCGAGATTCGGATGGATTCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_017424.2-478s1c1
Sequence:CCGGCCAAGCATCTCATTGAGAGAACTCGAGTTCTCTCAATGAGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017424.2-1053s1c1
Sequence:CCGGCCTGAGTTTATTGGAATCAAACTCGAGTTTGATTCCAATAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017424.2-697s21c1
Sequence:CCGGGGATTCTGCTGGAGGATTATCCTCGAGGATAATCCTCCAGCAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017424.2-814s21c1
Sequence:CCGGATGTTGTCTGGTCGAAATTTGCTCGAGCAAATTTCGACCAGACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017424.2-555s21c1
Sequence:CCGGGACATTGGCATCGTGACTATGCTCGAGCATAGTCACGATGCCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks