EMAIL THIS PAGE TO A FRIEND

CECR2

cat eye syndrome chromosome region, candidate 2

UniProtKB ID: Q9BXF3, A8MS90, A8MX16, Q658Z4, Q96P58, Q9C0C3
Gene ID:
Mouse(330409) cat eye syndrome chromosome region, candidate 2
Rat(500308) cat eye syndrome chromosome region, candidate 2
chicken(418161) cat eye syndrome chromosome region, candidate 2
dog(477738) cat eye syndrome chromosome region, candidate 2
domestic cat(101094605) cat eye syndrome chromosome region, candidate 2
cow(517202) cat eye syndrome chromosome region, candidate 2
naked mole-rat(101714324) cat eye syndrome chromosome region, candidate 2
domestic guinea pig(100727621) cat eye syndrome chromosome region, candidate 2
sheep(101117325) cat eye syndrome chromosome region, candidate 2
Gene Class: Cytoskeleton
230 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA002943 Anti-CECR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031413 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001128151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001128151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001128151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031413 Rosetta Predictions human pricing
XM_926014 Rosetta Predictions human pricing
XM_930894 Rosetta Predictions human pricing
XM_575657 Rosetta Predictions rat pricing
NM_001128151 Rosetta Predictions mouse pricing
XM_001001703 Rosetta Predictions mouse pricing
XM_204234 Rosetta Predictions mouse pricing
XM_622936 Rosetta Predictions mouse pricing
XM_901110 Rosetta Predictions mouse pricing
XM_917798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358785 predicted 3853
2 SASI_Hs02_00358786 predicted 3805
3 SASI_Hs02_00358787 predicted 1511
4 SASI_Hs02_00358788 predicted 4278
5 SASI_Hs02_00358789 predicted 3085
6 SASI_Hs02_00358790 predicted 2220
7 SASI_Hs02_00358791 predicted 3661
8 SASI_Hs02_00358792 predicted 4466
9 SASI_Hs02_00358793 predicted 3822
10 SASI_Hs02_00358794 predicted 2325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261736 predicted 3937
2 SASI_Hs01_00261737 predicted 3894
3 SASI_Hs01_00261738 predicted 1590
4 SASI_Hs01_00261739 predicted 4368
5 SASI_Hs01_00261740 predicted 1479
6 SASI_Hs01_00261741 predicted 2303
7 SASI_Hs01_00261742 predicted 3741
8 SASI_Hs01_00261743 predicted 3897
9 SASI_Hs01_00261744 predicted 2411
10 SASI_Hs01_00261745 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294695 predicted 1101
2 SASI_Hs01_00294696 predicted 1257
3 SASI_Hs01_00294697 predicted 1220
4 SASI_Hs01_00294698 predicted 803
5 SASI_Hs01_00294699 predicted 1059
6 SASI_Hs01_00294700 predicted 1032
7 SASI_Hs01_00294701 predicted 1247
8 SASI_Hs01_00294702 predicted 864
9 SASI_Hs01_00294703 predicted 1222
10 SASI_Hs01_00294704 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404018 predicted 1426
2 SASI_Rn02_00404019 predicted 2557
3 SASI_Rn02_00404020 predicted 426
4 SASI_Rn02_00404021 predicted 2249
5 SASI_Rn02_00404022 predicted 2990
6 SASI_Rn02_00404023 predicted 2224
7 SASI_Rn02_00404024 predicted 3397
8 SASI_Rn02_00404025 predicted 1327
9 SASI_Rn02_00404026 predicted 2874
10 SASI_Rn02_00404027 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310578 predicted 3762
2 SASI_Mm02_00310579 predicted 2297
3 SASI_Mm02_00310580 predicted 391
4 SASI_Mm02_00310581 predicted 1503
5 SASI_Mm02_00310582 predicted 1305
6 SASI_Mm02_00310583 predicted 2506
7 SASI_Mm02_00310584 predicted 2007
8 SASI_Mm02_00310585 predicted 1292
9 SASI_Mm02_00310586 predicted 2176
10 SASI_Mm02_00310587 predicted 2441
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277297 predicted 3686
2 SASI_Mm01_00277298 predicted 2215
3 SASI_Mm01_00277299 predicted 398
4 SASI_Mm01_00277300 predicted 1426
5 SASI_Mm01_00277301 predicted 2424
6 SASI_Mm01_00277302 predicted 1929
7 SASI_Mm01_00277303 predicted 1215
8 SASI_Mm01_00277304 predicted 2095
9 SASI_Mm01_00277305 predicted 2369
10 SASI_Mm01_00277306 predicted 3733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_204234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221729 predicted 3769
2 SASI_Mm01_00221730 predicted 2299
3 SASI_Mm01_00221731 predicted 1503
4 SASI_Mm01_00221732 predicted 2514
5 SASI_Mm01_00221733 predicted 2013
6 SASI_Mm01_00221734 predicted 1301
7 SASI_Mm01_00221735 predicted 2186
8 SASI_Mm01_00221736 predicted 2450
9 SASI_Mm01_00221737 predicted 1058
10 SASI_Mm01_00221738 predicted 3811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428032 predicted 3764
2 SASI_Mm02_00428033 predicted 2296
3 SASI_Mm02_00428034 predicted 397
4 SASI_Mm02_00428035 predicted 1506
5 SASI_Mm02_00428036 predicted 1302
6 SASI_Mm02_00428037 predicted 2507
7 SASI_Mm02_00428038 predicted 2009
8 SASI_Mm02_00428039 predicted 1287
9 SASI_Mm02_00428040 predicted 2178
10 SASI_Mm02_00428041 predicted 2441
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263482 predicted 403
2 SASI_Mm01_00263483 predicted 1505
3 SASI_Mm01_00263484 predicted 1312
4 SASI_Mm01_00263485 predicted 1612
5 SASI_Mm01_00263486 predicted 1292
6 SASI_Mm01_00263487 predicted 635
7 SASI_Mm01_00263488 predicted 1276
8 SASI_Mm01_00263489 predicted 1425
9 SASI_Mm01_00263490 predicted 1410
10 SASI_Mm01_00263491 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441405 predicted 3760
2 SASI_Mm02_00441406 predicted 2295
3 SASI_Mm02_00441407 predicted 395
4 SASI_Mm02_00441408 predicted 1506
5 SASI_Mm02_00441409 predicted 1304
6 SASI_Mm02_00441410 predicted 2506
7 SASI_Mm02_00441411 predicted 2010
8 SASI_Mm02_00441412 predicted 1288
9 SASI_Mm02_00441413 predicted 2178
10 SASI_Mm02_00441414 predicted 2444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031413
CECR2 MISSION shRNA Bacterial Glycerol Stock
cat eye syndrome chromosome region, candidate 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031413.2-5384s21c1
Sequence:CCGGGCTAGAGTGTTTCACGTATTACTCGAGTAATACGTGAAACACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-1404s21c1
Sequence:CCGGCCCTAACTATTATCAGATTATCTCGAGATAATCTGATAATAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-1457s21c1
Sequence:CCGGAGAAACTGAATGGAGGTTTATCTCGAGATAAACCTCCATTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-1561s21c1
Sequence:CCGGACCAAGATGTCTGATAATTTACTCGAGTAAATTATCAGACATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-113s21c1
Sequence:CCGGACTTCGAGATCGAGGAGTTAGCTCGAGCTAACTCCTCGATCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031413
CECR2 MISSION shRNA shRNA Plasmid DNA
cat eye syndrome chromosome region, candidate 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031413.2-5384s21c1
Sequence:CCGGGCTAGAGTGTTTCACGTATTACTCGAGTAATACGTGAAACACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-1404s21c1
Sequence:CCGGCCCTAACTATTATCAGATTATCTCGAGATAATCTGATAATAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-1457s21c1
Sequence:CCGGAGAAACTGAATGGAGGTTTATCTCGAGATAAACCTCCATTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-1561s21c1
Sequence:CCGGACCAAGATGTCTGATAATTTACTCGAGTAAATTATCAGACATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-113s21c1
Sequence:CCGGACTTCGAGATCGAGGAGTTAGCTCGAGCTAACTCCTCGATCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031413
CECR2 MISSION shRNA Lentiviral Transduction Particles
cat eye syndrome chromosome region, candidate 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031413.2-5384s21c1
Sequence:CCGGGCTAGAGTGTTTCACGTATTACTCGAGTAATACGTGAAACACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-1404s21c1
Sequence:CCGGCCCTAACTATTATCAGATTATCTCGAGATAATCTGATAATAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-1457s21c1
Sequence:CCGGAGAAACTGAATGGAGGTTTATCTCGAGATAAACCTCCATTCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-1561s21c1
Sequence:CCGGACCAAGATGTCTGATAATTTACTCGAGTAAATTATCAGACATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031413.2-113s21c1
Sequence:CCGGACTTCGAGATCGAGGAGTTAGCTCGAGCTAACTCCTCGATCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128151
CECR2 MISSION shRNA Bacterial Glycerol Stock
cat eye syndrome chromosome region, candidate 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-787s21c1
Sequence:CCGGAGCTACAGGAGGAGATTATATCTCGAGATATAATCTCCTCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-400s21c1
Sequence:CCGGGCTACTTGGAAGATATCATTACTCGAGTAATGATATCTTCCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-3931s21c1
Sequence:CCGGTAGATCTCGACAACCATAATGCTCGAGCATTATGGTTGTCGAGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128151.1-7829s21c1
Sequence:CCGGAGCATGTGCAGGTCGAAATAACTCGAGTTATTTCGACCTGCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-1507s21c1
Sequence:CCGGCCAACTATTACCAGATTATTACTCGAGTAATAATCTGGTAATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128151
CECR2 MISSION shRNA shRNA Plasmid DNA
cat eye syndrome chromosome region, candidate 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-787s21c1
Sequence:CCGGAGCTACAGGAGGAGATTATATCTCGAGATATAATCTCCTCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-400s21c1
Sequence:CCGGGCTACTTGGAAGATATCATTACTCGAGTAATGATATCTTCCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-3931s21c1
Sequence:CCGGTAGATCTCGACAACCATAATGCTCGAGCATTATGGTTGTCGAGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128151.1-7829s21c1
Sequence:CCGGAGCATGTGCAGGTCGAAATAACTCGAGTTATTTCGACCTGCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-1507s21c1
Sequence:CCGGCCAACTATTACCAGATTATTACTCGAGTAATAATCTGGTAATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128151
CECR2 MISSION shRNA Lentiviral Transduction Particles
cat eye syndrome chromosome region, candidate 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-787s21c1
Sequence:CCGGAGCTACAGGAGGAGATTATATCTCGAGATATAATCTCCTCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-400s21c1
Sequence:CCGGGCTACTTGGAAGATATCATTACTCGAGTAATGATATCTTCCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-3931s21c1
Sequence:CCGGTAGATCTCGACAACCATAATGCTCGAGCATTATGGTTGTCGAGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128151.1-7829s21c1
Sequence:CCGGAGCATGTGCAGGTCGAAATAACTCGAGTTATTTCGACCTGCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128151.1-1507s21c1
Sequence:CCGGCCAACTATTACCAGATTATTACTCGAGTAATAATCTGGTAATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks