EMAIL THIS PAGE TO A FRIEND

CECR5

cat eye syndrome chromosome region, candidate 5

54 Gene Product Result for
UniProtKB ID: Q9BXW7, B2RCK5, Q9BXW8, Q9NWA8, Q9NX41
Gene ID:
Mouse(214932) cat eye syndrome chromosome region, candidate 5
Rat(312680) cat eye syndrome chromosome region, candidate 5
chicken(418159) cat eye syndrome chromosome region, candidate 5
dog(477736) cat eye syndrome chromosome region, candidate 5
cow(514441) cat eye syndrome chromosome region, candidate 5
domestic cat(101095107) cat eye syndrome chromosome region, candidate 5
sheep(101117069) cat eye syndrome chromosome region, candidate 5
domestic guinea pig(100716887) cat eye syndrome chromosome region, candidate 5
naked mole-rat(101715290) cat eye syndrome chromosome region, candidate 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303048 ANTI-CECR5 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
HPA005548 Anti-CECR5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017829 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017829 Rosetta Predictions human pricing
NM_033070 Rosetta Predictions human pricing
NM_001107884 Rosetta Predictions rat pricing
NM_144815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149045 predicted 437
2 SASI_Hs01_00149046 predicted 887
3 SASI_Hs01_00149047 predicted 910
4 SASI_Hs02_00350702 predicted 323
5 SASI_Hs01_00149048 predicted 1351
6 SASI_Hs01_00149049 predicted 1354
7 SASI_Hs01_00149050 predicted 1452
8 SASI_Hs01_00149051 predicted 885
9 SASI_Hs01_00149052 predicted 746
10 SASI_Hs01_00149053 predicted 278
11 SASI_Hs01_00149054 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203624 predicted 507
2 SASI_Hs01_00203625 predicted 957
3 SASI_Hs01_00203626 predicted 988
4 SASI_Hs02_00360778 predicted 395
5 SASI_Hs01_00203627 predicted 1425
6 SASI_Hs01_00203628 predicted 1427
7 SASI_Hs01_00203629 predicted 1527
8 SASI_Hs01_00203630 predicted 958
9 SASI_Hs01_00203631 predicted 829
10 SASI_Hs01_00203632 predicted 351
11 SASI_Hs01_00203633 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233225 predicted 938
2 SASI_Rn02_00233226 predicted 627
3 SASI_Rn02_00233227 predicted 222
4 SASI_Rn02_00233228 predicted 922
5 SASI_Rn02_00233229 predicted 285
6 SASI_Rn02_00233230 predicted 933
7 SASI_Rn02_00233231 predicted 1383
8 SASI_Rn02_00233232 predicted 785
9 SASI_Rn02_00233233 predicted 633
10 SASI_Rn02_00233234 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064718 predicted 938
2 SASI_Mm01_00064719 predicted 1204
3 SASI_Mm01_00064720 predicted 1196
4 SASI_Mm01_00064721 predicted 803
5 SASI_Mm01_00064722 predicted 846
6 SASI_Mm01_00064723 predicted 922
7 SASI_Mm01_00064724 predicted 282
8 SASI_Mm01_00064725 predicted 770
9 SASI_Mm01_00064726 predicted 922
10 SASI_Mm01_00064727 predicted 1188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017829
VALIDATED
CECR5 MISSION shRNA Bacterial Glycerol Stock
cat eye syndrome chromosome region, candidate 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-722s21c1
Sequence:CCGGCTGTGCCTGGAAACCATTTACCTCGAGGTAAATGGTTTCCAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-1158s21c1
Sequence:CCGGACGTGGTGAATGACGTGAATGCTCGAGCATTCACGTCATTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-282s21c1
Sequence:CCGGAGGTGGATGCAGACCAAGTTACTCGAGTAACTTGGTCTGCATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017829.5-1395s21c1
Sequence:CCGGTTTCCCTGCTGGGTAGCATTTCTCGAGAAATGCTACCCAGCAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-890s21c1
Sequence:CCGGGATAACCCTATGTCTGACGTACTCGAGTACGTCAGACATAGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017829.4-890s1c1
Sequence:CCGGGATAACCCTATGTCTGACGTACTCGAGTACGTCAGACATAGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017829.4-787s1c1
Sequence:CCGGCAAACCCAGCATCCTCACTTACTCGAGTAAGTGAGGATGCTGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017829.4-214s1c1
Sequence:CCGGTGTTACAAATGCTGGGAACATCTCGAGATGTTCCCAGCATTTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017829.4-1118s1c1
Sequence:CCGGCGAGACTTATGCTTCAGTCCACTCGAGTGGACTGAAGCATAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017829.4-282s1c1
Sequence:CCGGAGGTGGATGCAGACCAAGTTACTCGAGTAACTTGGTCTGCATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017829
VALIDATED
CECR5 MISSION shRNA shRNA Plasmid DNA
cat eye syndrome chromosome region, candidate 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-722s21c1
Sequence:CCGGCTGTGCCTGGAAACCATTTACCTCGAGGTAAATGGTTTCCAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-1158s21c1
Sequence:CCGGACGTGGTGAATGACGTGAATGCTCGAGCATTCACGTCATTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-282s21c1
Sequence:CCGGAGGTGGATGCAGACCAAGTTACTCGAGTAACTTGGTCTGCATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017829.5-1395s21c1
Sequence:CCGGTTTCCCTGCTGGGTAGCATTTCTCGAGAAATGCTACCCAGCAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-890s21c1
Sequence:CCGGGATAACCCTATGTCTGACGTACTCGAGTACGTCAGACATAGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017829.4-890s1c1
Sequence:CCGGGATAACCCTATGTCTGACGTACTCGAGTACGTCAGACATAGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017829.4-787s1c1
Sequence:CCGGCAAACCCAGCATCCTCACTTACTCGAGTAAGTGAGGATGCTGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017829.4-214s1c1
Sequence:CCGGTGTTACAAATGCTGGGAACATCTCGAGATGTTCCCAGCATTTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017829.4-1118s1c1
Sequence:CCGGCGAGACTTATGCTTCAGTCCACTCGAGTGGACTGAAGCATAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017829.4-282s1c1
Sequence:CCGGAGGTGGATGCAGACCAAGTTACTCGAGTAACTTGGTCTGCATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017829
VALIDATED
CECR5 MISSION shRNA Lentiviral Transduction Particles
cat eye syndrome chromosome region, candidate 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-722s21c1
Sequence:CCGGCTGTGCCTGGAAACCATTTACCTCGAGGTAAATGGTTTCCAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-1158s21c1
Sequence:CCGGACGTGGTGAATGACGTGAATGCTCGAGCATTCACGTCATTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-282s21c1
Sequence:CCGGAGGTGGATGCAGACCAAGTTACTCGAGTAACTTGGTCTGCATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017829.5-1395s21c1
Sequence:CCGGTTTCCCTGCTGGGTAGCATTTCTCGAGAAATGCTACCCAGCAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017829.5-890s21c1
Sequence:CCGGGATAACCCTATGTCTGACGTACTCGAGTACGTCAGACATAGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017829.4-890s1c1
Sequence:CCGGGATAACCCTATGTCTGACGTACTCGAGTACGTCAGACATAGGGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017829.4-787s1c1
Sequence:CCGGCAAACCCAGCATCCTCACTTACTCGAGTAAGTGAGGATGCTGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017829.4-214s1c1
Sequence:CCGGTGTTACAAATGCTGGGAACATCTCGAGATGTTCCCAGCATTTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017829.4-1118s1c1
Sequence:CCGGCGAGACTTATGCTTCAGTCCACTCGAGTGGACTGAAGCATAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017829.4-282s1c1
Sequence:CCGGAGGTGGATGCAGACCAAGTTACTCGAGTAACTTGGTCTGCATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144815
CECR5 MISSION shRNA Bacterial Glycerol Stock
cat eye syndrome chromosome region, candidate 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-925s21c1
Sequence:CCGGGCTGTATGCTATAGGTGATAACTCGAGTTATCACCTATAGCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-147s21c1
Sequence:CCGGTTGGCTTACTGTTCGACATTGCTCGAGCAATGTCGAACAGTAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144815.2-610s1c1
Sequence:CCGGGACAAACCTGCAGCTGATTATCTCGAGATAATCAGCTGCAGGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144815.2-925s1c1
Sequence:CCGGGCTGTATGCTATAGGTGATAACTCGAGTTATCACCTATAGCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-611s21c1
Sequence:CCGGACAAACCTGCAGCTGATTATGCTCGAGCATAATCAGCTGCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-958s21c1
Sequence:CCGGTGTCTACGGTGCCAACCTATTCTCGAGAATAGGTTGGCACCGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144815.2-1717s21c1
Sequence:CCGGACCGCACAGTGCAACGTTATGCTCGAGCATAACGTTGCACTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184044    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144815.2-1759s1c1
Sequence:CCGGCCTTTGGTCACACTGAAGGAACTCGAGTTCCTTCAGTGTGACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144815
CECR5 MISSION shRNA shRNA Plasmid DNA
cat eye syndrome chromosome region, candidate 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-925s21c1
Sequence:CCGGGCTGTATGCTATAGGTGATAACTCGAGTTATCACCTATAGCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-147s21c1
Sequence:CCGGTTGGCTTACTGTTCGACATTGCTCGAGCAATGTCGAACAGTAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144815.2-610s1c1
Sequence:CCGGGACAAACCTGCAGCTGATTATCTCGAGATAATCAGCTGCAGGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144815.2-925s1c1
Sequence:CCGGGCTGTATGCTATAGGTGATAACTCGAGTTATCACCTATAGCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-611s21c1
Sequence:CCGGACAAACCTGCAGCTGATTATGCTCGAGCATAATCAGCTGCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-958s21c1
Sequence:CCGGTGTCTACGGTGCCAACCTATTCTCGAGAATAGGTTGGCACCGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144815.2-1717s21c1
Sequence:CCGGACCGCACAGTGCAACGTTATGCTCGAGCATAACGTTGCACTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184044    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144815.2-1759s1c1
Sequence:CCGGCCTTTGGTCACACTGAAGGAACTCGAGTTCCTTCAGTGTGACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144815
CECR5 MISSION shRNA Lentiviral Transduction Particles
cat eye syndrome chromosome region, candidate 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-925s21c1
Sequence:CCGGGCTGTATGCTATAGGTGATAACTCGAGTTATCACCTATAGCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-147s21c1
Sequence:CCGGTTGGCTTACTGTTCGACATTGCTCGAGCAATGTCGAACAGTAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144815.2-610s1c1
Sequence:CCGGGACAAACCTGCAGCTGATTATCTCGAGATAATCAGCTGCAGGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144815.2-925s1c1
Sequence:CCGGGCTGTATGCTATAGGTGATAACTCGAGTTATCACCTATAGCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-611s21c1
Sequence:CCGGACAAACCTGCAGCTGATTATGCTCGAGCATAATCAGCTGCAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144815.2-958s21c1
Sequence:CCGGTGTCTACGGTGCCAACCTATTCTCGAGAATAGGTTGGCACCGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144815.2-1717s21c1
Sequence:CCGGACCGCACAGTGCAACGTTATGCTCGAGCATAACGTTGCACTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184044    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144815.2-1759s1c1
Sequence:CCGGCCTTTGGTCACACTGAAGGAACTCGAGTTCCTTCAGTGTGACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks