EMAIL THIS PAGE TO A FRIEND

CECR6

cat eye syndrome chromosome region, candidate 6

94 Gene Product Result for
UniProtKB ID: Q9BXQ6, A8MYY1
Gene ID:
Mouse(94047) cat eye syndrome chromosome region, candidate 6
Rat(500307) cat eye syndrome chromosome region, candidate 6
chicken(772223) cat eye syndrome chromosome region, candidate 6
cow(100301173) cat eye syndrome chromosome region, candidate 6
domestic cat(101095346) cat eye syndrome chromosome region, candidate 6
dog(611977) cat eye syndrome chromosome region, candidate 6
domestic guinea pig(100716609) cat eye syndrome chromosome region, candidate 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031890 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031890 Rosetta Predictions human pricing
XM_001058567 Rosetta Predictions rat pricing
XM_575656 Rosetta Predictions rat pricing
NM_033567 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061541 predicted 2140
2 SASI_Hs02_00358997 predicted 1941
3 SASI_Hs01_00061542 predicted 2309
4 SASI_Hs01_00061543 predicted 1938
5 SASI_Hs01_00061544 predicted 2113
6 SASI_Hs01_00061545 predicted 1847
7 SASI_Hs01_00061546 predicted 1399
8 SASI_Hs01_00061547 predicted 1934
9 SASI_Hs02_00358998 predicted 1863
10 SASI_Hs01_00061549 predicted 2187
11 SASI_Hs01_00061548 predicted 2274
12 SASI_Hs01_00061550 predicted 2060
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290168 predicted 934
2 SASI_Rn02_00290169 predicted 1061
3 SASI_Rn02_00290170 predicted 1223
4 SASI_Rn02_00290171 predicted 976
5 SASI_Rn02_00290172 predicted 1007
6 SASI_Rn02_00290173 predicted 932
7 SASI_Rn02_00290174 predicted 1290
8 SASI_Rn02_00290175 predicted 1008
9 SASI_Rn02_00290176 predicted 964
10 SASI_Rn02_00290177 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404008 predicted 1430
2 SASI_Rn02_00404009 predicted 1722
3 SASI_Rn02_00404010 predicted 1270
4 SASI_Rn02_00404011 predicted 1779
5 SASI_Rn02_00404012 predicted 1501
6 SASI_Rn02_00404013 predicted 1695
7 SASI_Rn02_00404014 predicted 1459
8 SASI_Rn02_00404015 predicted 1685
9 SASI_Rn02_00404016 predicted 1543
10 SASI_Rn02_00404017 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103871 predicted 1024
2 SASI_Mm01_00103872 predicted 1751
3 SASI_Mm01_00103873 predicted 1834
4 SASI_Mm01_00103874 predicted 1257
5 SASI_Mm01_00103875 predicted 1526
6 SASI_Mm01_00103876 predicted 1747
7 SASI_Mm01_00103877 predicted 807
8 SASI_Mm01_00103878 predicted 1308
9 SASI_Mm01_00103879 predicted 1829
10 SASI_Mm01_00103880 predicted 1422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031890
CECR6 MISSION shRNA Bacterial Glycerol Stock
cat eye syndrome chromosome region, candidate 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031890.2-4122s1c1
Sequence:CCGGGCTGTGTTTCTCTGCTACCTACTCGAGTAGGTAGCAGAGAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031890.2-1626s1c1
Sequence:CCGGGCTCAAGAACCTCTTCTTCCTCTCGAGAGGAAGAAGAGGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031890.2-851s1c1
Sequence:CCGGCCATCTTCTTCGCCAAGAACACTCGAGTGTTCTTGGCGAAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031890.2-2453s1c1
Sequence:CCGGGCCTGGATTTGTGACCATGAACTCGAGTTCATGGTCACAAATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031890.3-1890s21c1
Sequence:CCGGCTCATGGCTATGTCAACACCCCTCGAGGGGTGTTGACATAGCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031890.3-1473s21c1
Sequence:CCGCACCTGCTTATCGCCGTCTACTCTCGAGAGTAGACGGCGATAAGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031890.3-2264s21c1
Sequence:CCGGGACCTTCTCCCTTGCTTAGAACTCGAGTTCTAAGCAAGGGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031890.3-2007s21c1
Sequence:CCGGGATTTGATCAGGGTCTATTTGCTCGAGCAAATAGACCCTGATCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031890
CECR6 MISSION shRNA shRNA Plasmid DNA
cat eye syndrome chromosome region, candidate 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031890.2-4122s1c1
Sequence:CCGGGCTGTGTTTCTCTGCTACCTACTCGAGTAGGTAGCAGAGAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031890.2-1626s1c1
Sequence:CCGGGCTCAAGAACCTCTTCTTCCTCTCGAGAGGAAGAAGAGGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031890.2-851s1c1
Sequence:CCGGCCATCTTCTTCGCCAAGAACACTCGAGTGTTCTTGGCGAAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031890.2-2453s1c1
Sequence:CCGGGCCTGGATTTGTGACCATGAACTCGAGTTCATGGTCACAAATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031890.3-1890s21c1
Sequence:CCGGCTCATGGCTATGTCAACACCCCTCGAGGGGTGTTGACATAGCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031890.3-1473s21c1
Sequence:CCGCACCTGCTTATCGCCGTCTACTCTCGAGAGTAGACGGCGATAAGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031890.3-2264s21c1
Sequence:CCGGGACCTTCTCCCTTGCTTAGAACTCGAGTTCTAAGCAAGGGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031890.3-2007s21c1
Sequence:CCGGGATTTGATCAGGGTCTATTTGCTCGAGCAAATAGACCCTGATCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031890
CECR6 MISSION shRNA Lentiviral Transduction Particles
cat eye syndrome chromosome region, candidate 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031890.2-4122s1c1
Sequence:CCGGGCTGTGTTTCTCTGCTACCTACTCGAGTAGGTAGCAGAGAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031890.2-1626s1c1
Sequence:CCGGGCTCAAGAACCTCTTCTTCCTCTCGAGAGGAAGAAGAGGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031890.2-851s1c1
Sequence:CCGGCCATCTTCTTCGCCAAGAACACTCGAGTGTTCTTGGCGAAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031890.2-2453s1c1
Sequence:CCGGGCCTGGATTTGTGACCATGAACTCGAGTTCATGGTCACAAATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031890.3-1890s21c1
Sequence:CCGGCTCATGGCTATGTCAACACCCCTCGAGGGGTGTTGACATAGCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031890.3-1473s21c1
Sequence:CCGCACCTGCTTATCGCCGTCTACTCTCGAGAGTAGACGGCGATAAGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031890.3-2264s21c1
Sequence:CCGGGACCTTCTCCCTTGCTTAGAACTCGAGTTCTAAGCAAGGGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031890.3-2007s21c1
Sequence:CCGGGATTTGATCAGGGTCTATTTGCTCGAGCAAATAGACCCTGATCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033567
CECR6 MISSION shRNA Bacterial Glycerol Stock
cat eye syndrome chromosome region, candidate 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-1523s1c1
Sequence:CCGGGCTGTCCATCTTTATGCTCAACTCGAGTTGAGCATAAAGATGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-1731s1c1
Sequence:CCGGCATGGCTATGTCAACACTCTACTCGAGTAGAGTGTTGACATAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033567.1-3828s1c1
Sequence:CCGGGCTGTGTTTCTTGCTACCTAACTCGAGTTAGGTAGCAAGAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-698s1c1
Sequence:CCGGCATTGCAGTCACTGACCTGTACTCGAGTACAGGTCAGTGACTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-293s1c1
Sequence:CCGGCGAGAGCATTAGCATCAGCAACTCGAGTTGCTGATGCTAATGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033567
CECR6 MISSION shRNA shRNA Plasmid DNA
cat eye syndrome chromosome region, candidate 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-1523s1c1
Sequence:CCGGGCTGTCCATCTTTATGCTCAACTCGAGTTGAGCATAAAGATGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-1731s1c1
Sequence:CCGGCATGGCTATGTCAACACTCTACTCGAGTAGAGTGTTGACATAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033567.1-3828s1c1
Sequence:CCGGGCTGTGTTTCTTGCTACCTAACTCGAGTTAGGTAGCAAGAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-698s1c1
Sequence:CCGGCATTGCAGTCACTGACCTGTACTCGAGTACAGGTCAGTGACTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-293s1c1
Sequence:CCGGCGAGAGCATTAGCATCAGCAACTCGAGTTGCTGATGCTAATGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033567
CECR6 MISSION shRNA Lentiviral Transduction Particles
cat eye syndrome chromosome region, candidate 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-1523s1c1
Sequence:CCGGGCTGTCCATCTTTATGCTCAACTCGAGTTGAGCATAAAGATGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-1731s1c1
Sequence:CCGGCATGGCTATGTCAACACTCTACTCGAGTAGAGTGTTGACATAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033567.1-3828s1c1
Sequence:CCGGGCTGTGTTTCTTGCTACCTAACTCGAGTTAGGTAGCAAGAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-698s1c1
Sequence:CCGGCATTGCAGTCACTGACCTGTACTCGAGTACAGGTCAGTGACTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033567.1-293s1c1
Sequence:CCGGCGAGAGCATTAGCATCAGCAACTCGAGTTGCTGATGCTAATGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks