EMAIL THIS PAGE TO A FRIEND

CEL

carboxyl ester lipase

55 Gene Product Result for
Synonyms: BAL BSDL BSSL CELL CEase FAP FAPP LIPA MODY8
UniProtKB ID: P19835, Q16398, Q5T7U7, Q9UCH1, Q9UP41
Gene ID:
Human(1056) Summary: The protein encoded by this gene is a glycoprotein secreted from the pancreas into the digestive tract and from the lactating mammary gland into human milk. The physiological role of this protein is in cholesterol and lipid-soluble vitamin ester hydrolysis and absorption. This encoded protein promotes large chylomicron production in the intestine. Also its presence in plasma suggests its interactions with cholesterol and oxidized lipoproteins to modulate the progression of atherosclerosis. In pancreatic tumoral cells, this encoded protein is thought to be sequestrated within the Golgi compartment and is probably not secreted. This gene contains a variable number of tandem repeat (VNTR) polymorphism in the coding region that may influence the function of the encoded protein. [provided by RefSeq, Jul 2008]
Mouse(12613) carboxyl ester lipase
Rat(24254) carboxyl ester lipase
fruit fly(45833) celibate
cow(280748) carboxyl ester lipase (bile salt-stimulated lipase)
chicken(417165) carboxyl ester lipase (bile salt-stimulated lipase)
dog(491280) carboxyl ester lipase (bile salt-stimulated lipase)
domestic cat(101080585) carboxyl ester lipase (bile salt-stimulated lipase)
Horse(100066592) carboxyl ester lipase (bile salt-stimulated lipase)
domestic guinea pig(100724301) carboxyl ester lipase
sheep(101112299) carboxyl ester lipase (bile salt-stimulated lipase)
Domestic Rabbit(100009339) carboxyl ester lipase (bile salt-stimulated lipase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0285 AQUA Peptide LSLLGGDSVDIF[K] mouse, rat pricing
AQ0284 AQUA Peptide TLENPQ[R] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001807 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001807 Rosetta Predictions human pricing
NM_016997 Rosetta Predictions rat pricing
NM_009885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332583 predicted 711
2 SASI_Hs01_00230060 predicted 845
3 SASI_Hs01_00230063 predicted 479
4 SASI_Hs01_00230064 predicted 544
5 SASI_Hs01_00230066 predicted 1375
6 SASI_Hs01_00230067 predicted 1392
7 SASI_Hs02_00332584 predicted 445
8 SASI_Hs02_00332585 predicted 710
9 SASI_Hs02_00332586 predicted 557
10 SASI_Hs02_00332587 predicted 1391
11 SASI_Hs01_00230058 predicted 1160
12 SASI_Hs01_00230059 predicted 1317
13 SASI_Hs01_00230061 predicted 1309
14 SASI_Hs01_00230062 predicted 987
15 SASI_Hs01_00230065 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040765 predicted 584
2 SASI_Rn01_00040766 predicted 1563
3 SASI_Rn01_00040767 predicted 363
4 SASI_Rn01_00040768 predicted 1516
5 SASI_Rn01_00040769 predicted 299
6 SASI_Rn01_00040770 predicted 1381
7 SASI_Rn01_00040771 predicted 532
8 SASI_Rn01_00040772 predicted 285
9 SASI_Rn01_00040773 predicted 1233
10 SASI_Rn01_00040774 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080875 predicted 1295
2 SASI_Mm01_00080876 predicted 1361
3 SASI_Mm02_00317370 predicted 1145
4 SASI_Mm01_00080878 predicted 860
5 SASI_Mm01_00080879 predicted 1209
6 SASI_Mm01_00080880 predicted 515
7 SASI_Mm01_00080881 predicted 1030
8 SASI_Mm01_00080882 predicted 1082
9 SASI_Mm02_00317371 predicted 856
10 SASI_Mm01_00080883 predicted 1024
11 SASI_Mm01_00080877 predicted 1497
12 SASI_Mm01_00080884 predicted 543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001807
CEL MISSION shRNA Bacterial Glycerol Stock
carboxyl ester lipase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-380s1c1
Sequence:CCGGCCCGTTATGATCTGGATCTATCTCGAGATAGATCCAGATCATAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-551s1c1
Sequence:CCGGGCCAATCTGCCAGGTAACTATCTCGAGATAGTTACCTGGCAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-1387s1c1
Sequence:CCGGCCATGCAGATGACATTCAGTACTCGAGTACTGAATGTCATCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-1450s1c1
Sequence:CCGGCCAAGACAGGACAGTCTCTAACTCGAGTTAGAGACTGTCCTGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-1015s1c1
Sequence:CCGGCGACTATATAGCAGGCACCAACTCGAGTTGGTGCCTGCTATATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001807
CEL MISSION shRNA shRNA Plasmid DNA
carboxyl ester lipase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-380s1c1
Sequence:CCGGCCCGTTATGATCTGGATCTATCTCGAGATAGATCCAGATCATAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-551s1c1
Sequence:CCGGGCCAATCTGCCAGGTAACTATCTCGAGATAGTTACCTGGCAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-1387s1c1
Sequence:CCGGCCATGCAGATGACATTCAGTACTCGAGTACTGAATGTCATCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-1450s1c1
Sequence:CCGGCCAAGACAGGACAGTCTCTAACTCGAGTTAGAGACTGTCCTGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-1015s1c1
Sequence:CCGGCGACTATATAGCAGGCACCAACTCGAGTTGGTGCCTGCTATATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001807
CEL MISSION shRNA Lentiviral Transduction Particles
carboxyl ester lipase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-380s1c1
Sequence:CCGGCCCGTTATGATCTGGATCTATCTCGAGATAGATCCAGATCATAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-551s1c1
Sequence:CCGGGCCAATCTGCCAGGTAACTATCTCGAGATAGTTACCTGGCAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-1387s1c1
Sequence:CCGGCCATGCAGATGACATTCAGTACTCGAGTACTGAATGTCATCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-1450s1c1
Sequence:CCGGCCAAGACAGGACAGTCTCTAACTCGAGTTAGAGACTGTCCTGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001807.2-1015s1c1
Sequence:CCGGCGACTATATAGCAGGCACCAACTCGAGTTGGTGCCTGCTATATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009885
CEL MISSION shRNA Bacterial Glycerol Stock
carboxyl ester lipase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-678s1c1
Sequence:CCGGCCCATACAACAAGGGTCTCATCTCGAGATGAGACCCTTGTTGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-1374s1c1
Sequence:CCGGCCTCCAGTACGTCTTTGGAAACTCGAGTTTCCAAAGACGTACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-865s1c1
Sequence:CCGGGCCTACAAGTTGCCCGTGAAACTCGAGTTTCACGGGCAACTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-1524s1c1
Sequence:CCGGGTACCCTTATACCTTGGAGAACTCGAGTTCTCCAAGGTATAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-222s1c1
Sequence:CCGGGCTGAAGGCTACAAACTTCAACTCGAGTTGAAGTTTGTAGCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009885
CEL MISSION shRNA shRNA Plasmid DNA
carboxyl ester lipase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-678s1c1
Sequence:CCGGCCCATACAACAAGGGTCTCATCTCGAGATGAGACCCTTGTTGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-1374s1c1
Sequence:CCGGCCTCCAGTACGTCTTTGGAAACTCGAGTTTCCAAAGACGTACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-865s1c1
Sequence:CCGGGCCTACAAGTTGCCCGTGAAACTCGAGTTTCACGGGCAACTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-1524s1c1
Sequence:CCGGGTACCCTTATACCTTGGAGAACTCGAGTTCTCCAAGGTATAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-222s1c1
Sequence:CCGGGCTGAAGGCTACAAACTTCAACTCGAGTTGAAGTTTGTAGCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009885
CEL MISSION shRNA Lentiviral Transduction Particles
carboxyl ester lipase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-678s1c1
Sequence:CCGGCCCATACAACAAGGGTCTCATCTCGAGATGAGACCCTTGTTGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-1374s1c1
Sequence:CCGGCCTCCAGTACGTCTTTGGAAACTCGAGTTTCCAAAGACGTACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-865s1c1
Sequence:CCGGGCCTACAAGTTGCCCGTGAAACTCGAGTTTCACGGGCAACTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-1524s1c1
Sequence:CCGGGTACCCTTATACCTTGGAGAACTCGAGTTCTCCAAGGTATAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009885.1-222s1c1
Sequence:CCGGGCTGAAGGCTACAAACTTCAACTCGAGTTGAAGTTTGTAGCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks