EMAIL THIS PAGE TO A FRIEND

CELA1

chymotrypsin-like elastase family, member 1

Synonyms: ELA1
UniProtKB ID: Q9UNI1, Q5MLF0, Q6DJT0, Q6ISM6
Gene ID:
Human(1990) Summary: Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, pancreatic elastase 1 is not expressed in the pancreas. To date, elastase 1 expression has only been detected in skin keratinocytes. Clinical literature that describes human elastase 1 activity in the pancreas or fecal material is actually referring to chymotrypsin-like elastase family, member 3B. [provided by RefSeq, May 2009]
Mouse(109901) chymotrypsin-like elastase family, member 1
Rat(24331) chymotrypsin-like elastase family, member 1
chicken(425200) chymotrypsin-like elastase family, member 1
cow(281139) chymotrypsin-like elastase family, member 1
dog(403515) chymotrypsin-like elastase family, member 1
domestic cat(494217) chymotrypsin-like elastase family, member 1
sheep(101114258) chymotrypsin-like elastase family, member 1
naked mole-rat(101715061) chymotrypsin-like elastase family, member 1
domestic guinea pig(100717214) chymotrypsin-like elastase family, member 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001971 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001971 Rosetta Predictions human pricing
NM_012552 Rosetta Predictions rat pricing
NM_033612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141682 predicted 680
2 SASI_Hs01_00141683 predicted 732
3 SASI_Hs02_00332941 predicted 225
4 SASI_Hs01_00141685 predicted 454
5 SASI_Hs01_00141686 predicted 297
6 SASI_Hs01_00141687 predicted 400
7 SASI_Hs01_00141688 predicted 292
8 SASI_Hs01_00141689 predicted 529
9 SASI_Hs01_00141690 predicted 415
10 SASI_Hs01_00141691 predicted 675
11 SASI_Hs01_00141684 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079120 predicted 360
2 SASI_Rn01_00079121 predicted 425
3 SASI_Rn01_00079123 predicted 377
4 SASI_Rn02_00259647 predicted 330
5 SASI_Rn02_00259648 predicted 375
6 SASI_Rn02_00259649 predicted 480
7 SASI_Rn02_00259650 predicted 422
8 SASI_Rn02_00259651 predicted 278
9 SASI_Rn02_00259652 predicted 428
10 SASI_Rn02_00259653 predicted 247
11 SASI_Rn01_00079122 predicted 263
12 SASI_Rn01_00079124 predicted 741
13 SASI_Rn01_00079125 predicted 622
14 SASI_Rn01_00079126 predicted 721
15 SASI_Rn01_00079127 predicted 860
16 SASI_Rn01_00079128 predicted 779
17 SASI_Rn01_00079129 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068934 predicted 846
2 SASI_Mm01_00068935 predicted 361
3 SASI_Mm01_00068936 predicted 457
4 SASI_Mm01_00068937 predicted 740
5 SASI_Mm01_00068938 predicted 260
6 SASI_Mm01_00068939 predicted 396
7 SASI_Mm01_00068940 predicted 212
8 SASI_Mm01_00068941 predicted 218
9 SASI_Mm01_00068942 predicted 224
10 SASI_Mm01_00068943 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001971
CELA1 MISSION shRNA Bacterial Glycerol Stock
chymotrypsin-like elastase family, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-311s1c1
Sequence:CCGGGAGTGTGCAGAAGATCGTGGTCTCGAGACCACGATCTTCTGCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-305s1c1
Sequence:CCGGGTACGTGAGTGTGCAGAAGATCTCGAGATCTTCTGCACACTCACGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001971.x-900s1c1
Sequence:CCGGCTGAAAGACTATTGAGCCATTCTCGAGAATGGCTCAATAGTCTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-268s1c1
Sequence:CCGGGAGACCATAACCTGAGCCAGACTCGAGTCTGGCTCAGGTTATGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-401s1c1
Sequence:CCGGCGTTACCCTCAATAGCTATGTCTCGAGACATAGCTATTGAGGGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001971.5-335s21c1
Sequence:CCGGTCCATACTGGAACAGCGATAACTCGAGTTATCGCTGTTCCAGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001971.5-677s21c1
Sequence:CCGGCTTGGTGAATGGCAAGTATTCCTCGAGGAATACTTGCCATTCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001971.5-777s21c1
Sequence:CCGGGCTTACATCTCCTGGATAAATCTCGAGATTTATCCAGGAGATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001971
CELA1 MISSION shRNA shRNA Plasmid DNA
chymotrypsin-like elastase family, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-311s1c1
Sequence:CCGGGAGTGTGCAGAAGATCGTGGTCTCGAGACCACGATCTTCTGCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-305s1c1
Sequence:CCGGGTACGTGAGTGTGCAGAAGATCTCGAGATCTTCTGCACACTCACGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001971.x-900s1c1
Sequence:CCGGCTGAAAGACTATTGAGCCATTCTCGAGAATGGCTCAATAGTCTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-268s1c1
Sequence:CCGGGAGACCATAACCTGAGCCAGACTCGAGTCTGGCTCAGGTTATGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-401s1c1
Sequence:CCGGCGTTACCCTCAATAGCTATGTCTCGAGACATAGCTATTGAGGGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001971.5-335s21c1
Sequence:CCGGTCCATACTGGAACAGCGATAACTCGAGTTATCGCTGTTCCAGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001971.5-677s21c1
Sequence:CCGGCTTGGTGAATGGCAAGTATTCCTCGAGGAATACTTGCCATTCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001971.5-777s21c1
Sequence:CCGGGCTTACATCTCCTGGATAAATCTCGAGATTTATCCAGGAGATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001971
CELA1 MISSION shRNA Lentiviral Transduction Particles
chymotrypsin-like elastase family, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-311s1c1
Sequence:CCGGGAGTGTGCAGAAGATCGTGGTCTCGAGACCACGATCTTCTGCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-305s1c1
Sequence:CCGGGTACGTGAGTGTGCAGAAGATCTCGAGATCTTCTGCACACTCACGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001971.x-900s1c1
Sequence:CCGGCTGAAAGACTATTGAGCCATTCTCGAGAATGGCTCAATAGTCTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-268s1c1
Sequence:CCGGGAGACCATAACCTGAGCCAGACTCGAGTCTGGCTCAGGTTATGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001971.x-401s1c1
Sequence:CCGGCGTTACCCTCAATAGCTATGTCTCGAGACATAGCTATTGAGGGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001971.5-335s21c1
Sequence:CCGGTCCATACTGGAACAGCGATAACTCGAGTTATCGCTGTTCCAGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001971.5-677s21c1
Sequence:CCGGCTTGGTGAATGGCAAGTATTCCTCGAGGAATACTTGCCATTCACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001971.5-777s21c1
Sequence:CCGGGCTTACATCTCCTGGATAAATCTCGAGATTTATCCAGGAGATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033612
VALIDATED
CELA1 MISSION shRNA Bacterial Glycerol Stock
chymotrypsin-like elastase family, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033612.1-885s1c1
Sequence:CCGGGAAGTAAGCAAGAAGGAGTTACTCGAGTAACTCCTTCTTGCTTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033612.1-251s1c1
Sequence:CCGGCCCATGACTTATCGAGTGGTTCTCGAGAACCACTCGATAAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033612.1-401s1c1
Sequence:CCGGGCCAAGAGTGTTACACTCAATCTCGAGATTGAGTGTAACACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033612.1-774s1c1
Sequence:CCGGCCAGAGTCTCTGCTTACATTTCTCGAGAAATGTAAGCAGAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033612.1-350s1c1
Sequence:CCGGTGGAACAAGAACAACGTGGTTCTCGAGAACCACGTTGTTCTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-686s21c1
Sequence:CCGGGCATGGTGAACGGTCAGTATGCTCGAGCATACTGACCGTTCACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-152s21c1
Sequence:CCGGTTTCCCTCCAGTACCAGTATGCTCGAGCATACTGGTACTGGAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-929s21c1
Sequence:CCGGGGCCGAGCACTTGTCTAATATCTCGAGATATTAGACAAGTGCTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033612.2-776s21c1
Sequence:CCGGCCAGAGTCTCTGCTTACATTTCTCGAGAAATGTAAGCAGAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-253s21c1
Sequence:CCGGCCCATGACTTATCGAGTGGTTCTCGAGAACCACTCGATAAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033612
VALIDATED
CELA1 MISSION shRNA shRNA Plasmid DNA
chymotrypsin-like elastase family, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033612.1-885s1c1
Sequence:CCGGGAAGTAAGCAAGAAGGAGTTACTCGAGTAACTCCTTCTTGCTTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033612.1-251s1c1
Sequence:CCGGCCCATGACTTATCGAGTGGTTCTCGAGAACCACTCGATAAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033612.1-401s1c1
Sequence:CCGGGCCAAGAGTGTTACACTCAATCTCGAGATTGAGTGTAACACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033612.1-774s1c1
Sequence:CCGGCCAGAGTCTCTGCTTACATTTCTCGAGAAATGTAAGCAGAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033612.1-350s1c1
Sequence:CCGGTGGAACAAGAACAACGTGGTTCTCGAGAACCACGTTGTTCTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-686s21c1
Sequence:CCGGGCATGGTGAACGGTCAGTATGCTCGAGCATACTGACCGTTCACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-152s21c1
Sequence:CCGGTTTCCCTCCAGTACCAGTATGCTCGAGCATACTGGTACTGGAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-929s21c1
Sequence:CCGGGGCCGAGCACTTGTCTAATATCTCGAGATATTAGACAAGTGCTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033612.2-776s21c1
Sequence:CCGGCCAGAGTCTCTGCTTACATTTCTCGAGAAATGTAAGCAGAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-253s21c1
Sequence:CCGGCCCATGACTTATCGAGTGGTTCTCGAGAACCACTCGATAAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033612
VALIDATED
CELA1 MISSION shRNA Lentiviral Transduction Particles
chymotrypsin-like elastase family, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033612.1-885s1c1
Sequence:CCGGGAAGTAAGCAAGAAGGAGTTACTCGAGTAACTCCTTCTTGCTTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033612.1-251s1c1
Sequence:CCGGCCCATGACTTATCGAGTGGTTCTCGAGAACCACTCGATAAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033612.1-401s1c1
Sequence:CCGGGCCAAGAGTGTTACACTCAATCTCGAGATTGAGTGTAACACTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033612.1-774s1c1
Sequence:CCGGCCAGAGTCTCTGCTTACATTTCTCGAGAAATGTAAGCAGAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033612.1-350s1c1
Sequence:CCGGTGGAACAAGAACAACGTGGTTCTCGAGAACCACGTTGTTCTTGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-686s21c1
Sequence:CCGGGCATGGTGAACGGTCAGTATGCTCGAGCATACTGACCGTTCACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-152s21c1
Sequence:CCGGTTTCCCTCCAGTACCAGTATGCTCGAGCATACTGGTACTGGAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-929s21c1
Sequence:CCGGGGCCGAGCACTTGTCTAATATCTCGAGATATTAGACAAGTGCTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033612.2-776s21c1
Sequence:CCGGCCAGAGTCTCTGCTTACATTTCTCGAGAAATGTAAGCAGAGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033612.2-253s21c1
Sequence:CCGGCCCATGACTTATCGAGTGGTTCTCGAGAACCACTCGATAAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks