EMAIL THIS PAGE TO A FRIEND

CELA2A

chymotrypsin-like elastase family, member 2A

41 Gene Product Result for
Synonyms: ELA2A PE-1
UniProtKB ID: P08217, B2R5I4, Q14243
Gene ID:
Human(63036) Summary: Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Like most of the human elastases, elastase 2A is secreted from the pancreas as a zymogen. In other species, elastase 2A has been shown to preferentially cleave proteins after leucine, methionine, and phenylalanine residues. [provided by RefSeq, May 2009]
Mouse(13706) chymotrypsin-like elastase family, member 2A
Rat(24332) chymotrypsin-like elastase family, member 2A
naked mole-rat(101723601) chymotrypsin-like elastase family, member 2A
sheep(101111210) chymotrypsin-like elastase family, member 2A
chicken(419486) chymotrypsin-like elastase family, member 2A
cow(282687) chymotrypsin-like elastase family, member 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033440 Rosetta Predictions human pricing
NM_012553 Rosetta Predictions rat pricing
NM_007919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110320 predicted 666
2 SASI_Hs01_00110321 predicted 674
3 SASI_Hs01_00110322 predicted 635
4 SASI_Hs01_00110323 predicted 524
5 SASI_Hs01_00110324 predicted 83
6 SASI_Hs01_00110325 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089157 predicted 640
2 SASI_Rn01_00089158 predicted 329
3 SASI_Rn01_00089159 predicted 675
4 SASI_Rn02_00259654 predicted 237
5 SASI_Rn01_00089160 predicted 606
6 SASI_Rn01_00089161 predicted 456
7 SASI_Rn01_00089162 predicted 677
8 SASI_Rn01_00089163 predicted 239
9 SASI_Rn01_00089164 predicted 451
10 SASI_Rn01_00089165 predicted 682
11 SASI_Rn01_00089166 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128358 predicted 239
2 SASI_Mm01_00128359 predicted 380
3 SASI_Mm01_00128360 predicted 465
4 SASI_Mm01_00128361 predicted 263
5 SASI_Mm01_00128363 predicted 237
6 SASI_Mm01_00128364 predicted 668
7 SASI_Mm01_00128366 predicted 334
8 SASI_Mm01_00128367 predicted 242
9 SASI_Mm02_00312735 predicted 466
10 SASI_Mm02_00312736 predicted 316
11 SASI_Mm01_00128362 predicted 486
12 SASI_Mm01_00128365 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033440
CELA2A MISSION shRNA Bacterial Glycerol Stock
chymotrypsin-like elastase family, member 2A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033440.2-530s21c1
Sequence:CCGGTGTTCCTGATGTCCTGCAGCACTCGAGTGCTGCAGGACATCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033440.2-369s21c1
Sequence:CCGGCAAATCTCCAAAGGGAACGACCTCGAGGTCGTTCCCTTTGGAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033440.2-353s21c1
Sequence:CCGGGGACTGGAACTCCAACCAAATCTCGAGATTTGGTTGGAGTTCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-87s1c1
Sequence:CCGGCTTACCCACCTTATGTGACTACTCGAGTAGTCACATAAGGTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-95s1c1
Sequence:CCGGCCTTATGTGACTAGGGTGGTTCTCGAGAACCACCCTAGTCACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-745s1c1
Sequence:CCGGCCTCGGCTGCAACTACTACCACTCGAGTGGTAGTAGTTGCAGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-320s1c1
Sequence:CCGGGCAGTCAGTGTCTCTAAGATTCTCGAGAATCTTAGAGACACTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-802s1c1
Sequence:CCGGCGACTGGATCAATTCGGTGATCTCGAGATCACCGAATTGATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033440
CELA2A MISSION shRNA shRNA Plasmid DNA
chymotrypsin-like elastase family, member 2A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033440.2-530s21c1
Sequence:CCGGTGTTCCTGATGTCCTGCAGCACTCGAGTGCTGCAGGACATCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033440.2-369s21c1
Sequence:CCGGCAAATCTCCAAAGGGAACGACCTCGAGGTCGTTCCCTTTGGAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033440.2-353s21c1
Sequence:CCGGGGACTGGAACTCCAACCAAATCTCGAGATTTGGTTGGAGTTCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-87s1c1
Sequence:CCGGCTTACCCACCTTATGTGACTACTCGAGTAGTCACATAAGGTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-95s1c1
Sequence:CCGGCCTTATGTGACTAGGGTGGTTCTCGAGAACCACCCTAGTCACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-745s1c1
Sequence:CCGGCCTCGGCTGCAACTACTACCACTCGAGTGGTAGTAGTTGCAGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-320s1c1
Sequence:CCGGGCAGTCAGTGTCTCTAAGATTCTCGAGAATCTTAGAGACACTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-802s1c1
Sequence:CCGGCGACTGGATCAATTCGGTGATCTCGAGATCACCGAATTGATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033440
CELA2A MISSION shRNA Lentiviral Transduction Particles
chymotrypsin-like elastase family, member 2A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033440.2-530s21c1
Sequence:CCGGTGTTCCTGATGTCCTGCAGCACTCGAGTGCTGCAGGACATCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033440.2-369s21c1
Sequence:CCGGCAAATCTCCAAAGGGAACGACCTCGAGGTCGTTCCCTTTGGAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033440.2-353s21c1
Sequence:CCGGGGACTGGAACTCCAACCAAATCTCGAGATTTGGTTGGAGTTCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-87s1c1
Sequence:CCGGCTTACCCACCTTATGTGACTACTCGAGTAGTCACATAAGGTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-95s1c1
Sequence:CCGGCCTTATGTGACTAGGGTGGTTCTCGAGAACCACCCTAGTCACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-745s1c1
Sequence:CCGGCCTCGGCTGCAACTACTACCACTCGAGTGGTAGTAGTTGCAGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-320s1c1
Sequence:CCGGGCAGTCAGTGTCTCTAAGATTCTCGAGAATCTTAGAGACACTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033440.1-802s1c1
Sequence:CCGGCGACTGGATCAATTCGGTGATCTCGAGATCACCGAATTGATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007919
CELA2A MISSION shRNA Bacterial Glycerol Stock
chymotrypsin-like elastase family, member 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-475s1c1
Sequence:CCGGCCGAGAAACTATGTCTGCTATCTCGAGATAGCAGACATAGTTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-79s1c1
Sequence:CCGGCCCACTTATGAGGTGGAGGATCTCGAGATCCTCCACCTCATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-249s1c1
Sequence:CCGGCCTCAGCAACTATCAGACCTACTCGAGTAGGTCTGATAGTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-373s1c1
Sequence:CCGGGTCGGCAATGGCTATGACATTCTCGAGAATGTCATAGCCATTGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-322s1c1
Sequence:CCGGGCTGTTCAAGTCTCTAAGCTTCTCGAGAAGCTTAGAGACTTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007919
CELA2A MISSION shRNA shRNA Plasmid DNA
chymotrypsin-like elastase family, member 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-475s1c1
Sequence:CCGGCCGAGAAACTATGTCTGCTATCTCGAGATAGCAGACATAGTTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-79s1c1
Sequence:CCGGCCCACTTATGAGGTGGAGGATCTCGAGATCCTCCACCTCATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-249s1c1
Sequence:CCGGCCTCAGCAACTATCAGACCTACTCGAGTAGGTCTGATAGTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-373s1c1
Sequence:CCGGGTCGGCAATGGCTATGACATTCTCGAGAATGTCATAGCCATTGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-322s1c1
Sequence:CCGGGCTGTTCAAGTCTCTAAGCTTCTCGAGAAGCTTAGAGACTTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007919
CELA2A MISSION shRNA Lentiviral Transduction Particles
chymotrypsin-like elastase family, member 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-475s1c1
Sequence:CCGGCCGAGAAACTATGTCTGCTATCTCGAGATAGCAGACATAGTTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-79s1c1
Sequence:CCGGCCCACTTATGAGGTGGAGGATCTCGAGATCCTCCACCTCATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-249s1c1
Sequence:CCGGCCTCAGCAACTATCAGACCTACTCGAGTAGGTCTGATAGTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-373s1c1
Sequence:CCGGGTCGGCAATGGCTATGACATTCTCGAGAATGTCATAGCCATTGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007919.1-322s1c1
Sequence:CCGGGCTGTTCAAGTCTCTAAGCTTCTCGAGAAGCTTAGAGACTTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks