EMAIL THIS PAGE TO A FRIEND

CELA2B

chymotrypsin-like elastase family, member 2B

16 Gene Product Result for
Synonyms: ELA2B
Species: Human CELA2B(51032)
UniProtKB ID: P08218, Q14D16, Q6ISM5, Q96QV5
Gene ID:
Human(51032) Summary: Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Like most of the human elastases, elastase 2B is secreted from the pancreas as a zymogen. In other species, elastase 2B has been shown to preferentially cleave proteins after leucine, methionine, and phenylalanine residues. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301717 ANTI-CEL2B (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015849 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153061 MISSION® esiRNA esiRNA human CELA2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015849 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098426 predicted 606
2 SASI_Hs01_00098427 predicted 637
3 SASI_Hs01_00098428 predicted 672
4 SASI_Hs01_00098429 predicted 273
5 SASI_Hs01_00098430 predicted 270
6 SASI_Hs01_00098431 predicted 671
7 SASI_Hs01_00098432 predicted 281
8 SASI_Hs01_00098433 predicted 255
9 SASI_Hs01_00098434 predicted 600
10 SASI_Hs01_00098435 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015849
CELA2B MISSION shRNA Bacterial Glycerol Stock
chymotrypsin-like elastase family, member 2B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-745s1c1
Sequence:CCGGCCTTGGTTGCAACTACTACTACTCGAGTAGTAGTAGTTGCAACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-607s1c1
Sequence:CCGGCACCGTGAAGACGAATATGATCTCGAGATCATATTCGTCTTCACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-269s1c1
Sequence:CCGGCGCGTGATGCTGGGCCAGCATCTCGAGATGCTGGCCCAGCATCACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-95s1c1
Sequence:CCGGCCTGATATGTCTAGGATGCTTCTCGAGAAGCATCCTAGACATATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-91s1c1
Sequence:CCGGCGCGCCTGATATGTCTAGGATCTCGAGATCCTAGACATATCAGGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015849.2-757s21c1
Sequence:CCGGCTACTACTACAAGCCCTCCATCTCGAGATGGAGGGCTTGTAGTAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015849.2-285s21c1
Sequence:CCGGAGCATAACCTCTACGTTGCAGCTCGAGCTGCAACGTAGAGGTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015849.2-648s21c1
Sequence:CCGGTGATATGCACCTGCAACGGAGCTCGAGCTCCGTTGCAGGTGCATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015849
CELA2B MISSION shRNA shRNA Plasmid DNA
chymotrypsin-like elastase family, member 2B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-745s1c1
Sequence:CCGGCCTTGGTTGCAACTACTACTACTCGAGTAGTAGTAGTTGCAACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-607s1c1
Sequence:CCGGCACCGTGAAGACGAATATGATCTCGAGATCATATTCGTCTTCACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-269s1c1
Sequence:CCGGCGCGTGATGCTGGGCCAGCATCTCGAGATGCTGGCCCAGCATCACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-95s1c1
Sequence:CCGGCCTGATATGTCTAGGATGCTTCTCGAGAAGCATCCTAGACATATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-91s1c1
Sequence:CCGGCGCGCCTGATATGTCTAGGATCTCGAGATCCTAGACATATCAGGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015849.2-757s21c1
Sequence:CCGGCTACTACTACAAGCCCTCCATCTCGAGATGGAGGGCTTGTAGTAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015849.2-285s21c1
Sequence:CCGGAGCATAACCTCTACGTTGCAGCTCGAGCTGCAACGTAGAGGTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015849.2-648s21c1
Sequence:CCGGTGATATGCACCTGCAACGGAGCTCGAGCTCCGTTGCAGGTGCATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015849
CELA2B MISSION shRNA Lentiviral Transduction Particles
chymotrypsin-like elastase family, member 2B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-745s1c1
Sequence:CCGGCCTTGGTTGCAACTACTACTACTCGAGTAGTAGTAGTTGCAACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-607s1c1
Sequence:CCGGCACCGTGAAGACGAATATGATCTCGAGATCATATTCGTCTTCACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-269s1c1
Sequence:CCGGCGCGTGATGCTGGGCCAGCATCTCGAGATGCTGGCCCAGCATCACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-95s1c1
Sequence:CCGGCCTGATATGTCTAGGATGCTTCTCGAGAAGCATCCTAGACATATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015849.1-91s1c1
Sequence:CCGGCGCGCCTGATATGTCTAGGATCTCGAGATCCTAGACATATCAGGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015849.2-757s21c1
Sequence:CCGGCTACTACTACAAGCCCTCCATCTCGAGATGGAGGGCTTGTAGTAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015849.2-285s21c1
Sequence:CCGGAGCATAACCTCTACGTTGCAGCTCGAGCTGCAACGTAGAGGTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015849.2-648s21c1
Sequence:CCGGTGATATGCACCTGCAACGGAGCTCGAGCTCCGTTGCAGGTGCATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)