EMAIL THIS PAGE TO A FRIEND

CELA3A

chymotrypsin-like elastase family, member 3A

34 Gene Product Result for
Synonyms: ELA3 ELA3A
Species: Human CELA3A(10136)
UniProtKB ID: P09093, B1AQ53, Q9BRW4
Gene ID:
Human(10136) Summary: Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, elastase 3A has little elastolytic activity. Like most of the human elastases, elastase 3A is secreted from the pancreas as a zymogen and, like other serine proteases such as trypsin, chymotrypsin and kallikrein, it has a digestive function in the intestine. Elastase 3A preferentially cleaves proteins after alanine residues. Elastase 3A may also function in the intestinal transport and metabolism of cholesterol. Both elastase 3A and elastase 3B have been referred to as protease E and as elastase 1. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005747 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005747 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083400 predicted 324
2 SASI_Hs01_00083404 predicted 266
3 SASI_Hs02_00340199 predicted 243
4 SASI_Hs01_00083397 predicted 270
5 SASI_Hs01_00083398 predicted 234
6 SASI_Hs02_00340200 predicted 313
7 SASI_Hs02_00340201 predicted 330
8 SASI_Hs02_00340202 predicted 320
9 SASI_Hs02_00340203 predicted 734
10 SASI_Hs02_00340204 predicted 738
11 SASI_Hs01_00083395 predicted 393
12 SASI_Hs01_00083396 predicted 629
13 SASI_Hs01_00083399 predicted 628
14 SASI_Hs01_00083401 predicted 465
15 SASI_Hs01_00083402 predicted 460
16 SASI_Hs01_00083403 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005747
CELA3A MISSION shRNA Bacterial Glycerol Stock
chymotrypsin-like elastase family, member 3A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005747.4-520s21c1
Sequence:CCGGCAATGGGCCACTCCCAGACAACTCGAGTTGTCTGGGAGTGGCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005747.4-572s21c1
Sequence:CCGGTATAAGCACTGCTCCAGGTGGCTCGAGCCACCTGGAGCAGTGCTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-741s1c1
Sequence:CCGGTGGCTGCAACTTCATCTGGAACTCGAGTTCCAGATGAAGTTGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-265s1c1
Sequence:CCGGGTGTTGGGTGAGTACAACCTTCTCGAGAAGGTTGTACTCACCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-325s1c1
Sequence:CCGGTCTGAGGAGCTGTTTGTGCATCTCGAGATGCACAAACAGCTCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-753s1c1
Sequence:CCGGCATCTGGAAGCCCACGGTGTTCTCGAGAACACCGTGGGCTTCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-231s1c1
Sequence:CCGGCCACTGCATCTCGAGGGATCTCTCGAGAGATCCCTCGAGATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005747
CELA3A MISSION shRNA shRNA Plasmid DNA
chymotrypsin-like elastase family, member 3A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005747.4-520s21c1
Sequence:CCGGCAATGGGCCACTCCCAGACAACTCGAGTTGTCTGGGAGTGGCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005747.4-572s21c1
Sequence:CCGGTATAAGCACTGCTCCAGGTGGCTCGAGCCACCTGGAGCAGTGCTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-741s1c1
Sequence:CCGGTGGCTGCAACTTCATCTGGAACTCGAGTTCCAGATGAAGTTGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-265s1c1
Sequence:CCGGGTGTTGGGTGAGTACAACCTTCTCGAGAAGGTTGTACTCACCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-325s1c1
Sequence:CCGGTCTGAGGAGCTGTTTGTGCATCTCGAGATGCACAAACAGCTCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-753s1c1
Sequence:CCGGCATCTGGAAGCCCACGGTGTTCTCGAGAACACCGTGGGCTTCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-231s1c1
Sequence:CCGGCCACTGCATCTCGAGGGATCTCTCGAGAGATCCCTCGAGATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005747
CELA3A MISSION shRNA Lentiviral Transduction Particles
chymotrypsin-like elastase family, member 3A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005747.4-520s21c1
Sequence:CCGGCAATGGGCCACTCCCAGACAACTCGAGTTGTCTGGGAGTGGCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005747.4-572s21c1
Sequence:CCGGTATAAGCACTGCTCCAGGTGGCTCGAGCCACCTGGAGCAGTGCTTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-741s1c1
Sequence:CCGGTGGCTGCAACTTCATCTGGAACTCGAGTTCCAGATGAAGTTGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-265s1c1
Sequence:CCGGGTGTTGGGTGAGTACAACCTTCTCGAGAAGGTTGTACTCACCCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-325s1c1
Sequence:CCGGTCTGAGGAGCTGTTTGTGCATCTCGAGATGCACAAACAGCTCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-753s1c1
Sequence:CCGGCATCTGGAAGCCCACGGTGTTCTCGAGAACACCGTGGGCTTCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005747.2-231s1c1
Sequence:CCGGCCACTGCATCTCGAGGGATCTCTCGAGAGATCCCTCGAGATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks